ID: 1179947978

View in Genome Browser
Species Human (GRCh38)
Location 21:44691748-44691770
Sequence TTCACCAGTAAAGCTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179947978 Original CRISPR TTCACCAGTAAAGCTGTTGT TGG (reversed) Intronic
900391376 1:2435424-2435446 GGCACCAGCAAAGCTGTTTTAGG + Intronic
909961135 1:81843956-81843978 TTCACCAGTAGGTCTGTTGTTGG + Intronic
910758073 1:90712063-90712085 TTCACCAGTCACACTGCTGTGGG + Exonic
910793959 1:91079529-91079551 TCTACCAATAAAGCTGTTGGAGG - Intergenic
918685498 1:187409709-187409731 AACACCAGCAAAGTTGTTGTTGG - Intergenic
919248795 1:195026102-195026124 TTCACCTGTAAAGAAGTTATTGG + Intergenic
1063055778 10:2502762-2502784 TTCACCTCTAAAGATTTTGTTGG - Intergenic
1065672406 10:28134560-28134582 TTCCCCATTAAAACTCTTGTTGG - Intronic
1067209270 10:44245113-44245135 TTCACTCTTAAAACTGTTGTGGG - Intergenic
1068961412 10:62870188-62870210 CTCACCAGTGATGCTATTGTTGG - Intronic
1069249354 10:66247725-66247747 TTCACCAGTAATACTATTGTAGG - Intronic
1069481811 10:68789746-68789768 TTCACCAGAGAGGCTTTTGTTGG - Exonic
1074821658 10:117183932-117183954 ATCAGCAATAAAGCTGATGTAGG - Intergenic
1078526109 11:12102790-12102812 TTGACCAGTGAAGCTGGTTTGGG + Intronic
1078677280 11:13434025-13434047 ATCACCTGTAAGTCTGTTGTCGG + Intronic
1080616752 11:33951116-33951138 TTCAGCAGTGAAGTTATTGTAGG - Intergenic
1080910327 11:36590729-36590751 CTCACCAGTATAGCTGCTTTTGG - Intronic
1084633138 11:70369573-70369595 TTCACCAGTGAAGCTATCTTGGG + Intronic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1091456300 12:610546-610568 CCCACCAGTGAAGCTGTGGTGGG - Intronic
1093783337 12:23163025-23163047 TTCACCAGCAAAGCTATTCTTGG + Intergenic
1094626715 12:32131429-32131451 CTGACCAGTAAAGCTATGGTAGG - Intronic
1095872960 12:47050768-47050790 TTCACAATGAAAGCTGTTGGTGG + Intergenic
1098685524 12:73415165-73415187 TTCATCAATTAAGCTATTGTTGG - Intergenic
1099109523 12:78540044-78540066 TTCAAAAGTAAAGCTTTTGTGGG + Intergenic
1101981343 12:109409560-109409582 TTCACCAGGAAAACTGTAATTGG + Exonic
1106198773 13:27518234-27518256 TTCACCATTAAATATGGTGTTGG - Intergenic
1107507891 13:41053558-41053580 GTCACCAGTAAAGCAGAAGTGGG - Intronic
1108821855 13:54361359-54361381 TTCTTCAGTAAAGCTGTGATTGG - Intergenic
1109024597 13:57142312-57142334 TTCACCCGTCAAGCAGTTATAGG - Intronic
1109025584 13:57148882-57148904 TTCACCCGTCAAGCAGTTATAGG - Intronic
1109026574 13:57155455-57155477 TTCACCCGTCAAGCAGTTATAGG - Intronic
1109027566 13:57162026-57162048 TTCACCCGTCAAGCAGTTATAGG - Intronic
1109028552 13:57168591-57168613 TTCACCCGTCAAGCAGTTATAGG - Intronic
1110900703 13:80819975-80819997 TTCACTAGTAAGGATGGTGTTGG - Intergenic
1111301342 13:86354570-86354592 TTTTCCAGTAATGATGTTGTAGG + Intergenic
1111814441 13:93132975-93132997 TTCAGCAATAAAAATGTTGTAGG - Intergenic
1113490401 13:110687263-110687285 TCCAACAGCAAAGCTGTTGTGGG - Intronic
1113526292 13:110980529-110980551 TTCACATGTTAAGCTGTTGCAGG - Intergenic
1113596757 13:111539295-111539317 TCCACCAGTAAAGCAGGCGTGGG + Intergenic
1113915224 13:113866805-113866827 ATCACAAATAAAGCTGCTGTAGG + Intergenic
1114033058 14:18593121-18593143 TACAACAGTAAAGCTATTTTGGG - Intergenic
1114077854 14:19172318-19172340 TACAACAGTAAAGCTATTCTGGG - Intergenic
1114125884 14:19724649-19724671 TACAACAGTAAAGCTATTCTGGG + Intronic
1115129192 14:30033385-30033407 TTCACCACTAAATTTATTGTTGG - Intronic
1115324105 14:32117458-32117480 TTGACCAGTAATGCTTTTATTGG + Intronic
1118348788 14:64958981-64959003 GTCACCAGCAAACCTGTTGATGG - Intronic
1120596185 14:86440544-86440566 TTCACCACTAATGGTGGTGTTGG + Intergenic
1122120117 14:99548553-99548575 TTCACTAGTACAGCTGGTGTTGG - Intronic
1123569115 15:21583944-21583966 TACAACAGTAAAGCTATTCTGGG + Intergenic
1123605225 15:22019265-22019287 TACAACAGTAAAGCTATTCTGGG + Intergenic
1202977467 15_KI270727v1_random:311034-311056 TACAACAGTAAAGCTATTCTGGG + Intergenic
1133669727 16:8006652-8006674 TTCACCAGGGAAGCTCTTGCTGG - Intergenic
1135384557 16:22025726-22025748 TTCCCCTGCAGAGCTGTTGTAGG - Intronic
1140670805 16:77277215-77277237 TTCACCAGTAAAGTATTAGTTGG - Intronic
1142046776 16:87930567-87930589 CTGACGAGTAAAGCTGCTGTGGG + Intronic
1150727633 17:67664327-67664349 TTCATCAGTAATGCAGTTGCTGG + Intronic
1155357041 18:24962907-24962929 CTCACCTCTCAAGCTGTTGTAGG - Intergenic
1155801782 18:30114943-30114965 TTCACCAGTACTGCTGTCTTAGG - Intergenic
1159081237 18:63738406-63738428 TTGAGCAGTAAATCTATTGTTGG - Intergenic
1159459559 18:68706508-68706530 TTCACCAGTAGGACTGGTGTGGG + Intronic
1162099065 19:8328788-8328810 TATACCTGTAAAGCTGATGTGGG + Intronic
1165737543 19:38186154-38186176 ATCACTGGGAAAGCTGTTGTTGG - Intronic
928257054 2:29731894-29731916 GTGACCTGTAAAGGTGTTGTAGG + Intronic
928448751 2:31358807-31358829 TTCACCATTAAATATGTTATTGG - Intronic
929662626 2:43803787-43803809 ATCACCAGTAAAACAGTTTTGGG + Intronic
930962605 2:57278743-57278765 TTCACCAAAAAAGCTGTTGGTGG + Intergenic
933675620 2:85054103-85054125 CACACCAGTAAAGCTACTGTTGG + Exonic
933891637 2:86777295-86777317 TTCTCCAGCAAGGCAGTTGTGGG + Exonic
935076129 2:99746309-99746331 TCCACGAGTATAGCTGTTATGGG + Intronic
938997016 2:136690728-136690750 TACAACAGTAAAACTGTTGAAGG + Intergenic
940590134 2:155713188-155713210 GTCACCAGTTAAGGGGTTGTTGG - Intergenic
944599234 2:201286294-201286316 TTTACCAGGAAAGCTGGGGTAGG + Intronic
945385516 2:209195402-209195424 TTCAGCAATAAAGCTGCTGAGGG - Intergenic
945559874 2:211326636-211326658 TTCACCAGAAAACATGTTGTGGG - Intergenic
946124300 2:217547670-217547692 TTCACTAGTGAAGCTGTGCTTGG - Intronic
946529113 2:220552538-220552560 TTCACTAATAAAGCTGGTCTTGG - Intergenic
1169776998 20:9265877-9265899 TTCTTCAGTAAATCTGTGGTGGG - Intronic
1169922402 20:10749397-10749419 TTCAGCAGTGAAACTGTTTTGGG + Intergenic
1174762091 20:53216278-53216300 TTCACCAGCCAAGCCATTGTTGG + Intronic
1175717917 20:61267825-61267847 TTCCACAGTAAAGCGGTTTTGGG - Intronic
1179947978 21:44691748-44691770 TTCACCAGTAAAGCTGTTGTTGG - Intronic
1180457173 22:15520176-15520198 TACAACAGTAAAGCTATTCTGGG - Intergenic
1182599464 22:31449437-31449459 TGGCCCAGTAAAGATGTTGTAGG + Exonic
1182955549 22:34421932-34421954 TTCACCATTAAACATGATGTTGG + Intergenic
1184983015 22:48107638-48107660 CTCACAATTAAAGCTGTTGGTGG - Intergenic
1185034411 22:48464260-48464282 TTGACAAGTAAATCTGATGTAGG - Intergenic
949376912 3:3400823-3400845 TGCACAAGCAAAGCAGTTGTGGG + Intergenic
951416434 3:22429066-22429088 TTCACCAGTAAGTCTATTTTAGG - Intergenic
954645657 3:52130100-52130122 TTTGCCAGCATAGCTGTTGTGGG - Intronic
961068305 3:123895632-123895654 TTCCCCAGTAATTCTGATGTGGG + Intergenic
961393975 3:126573261-126573283 TTAACCAGAAAAACTGTTTTAGG + Intronic
965058437 3:163751898-163751920 TTAATCAGTAAGGCTGTTTTTGG - Intergenic
965360892 3:167736045-167736067 TGCACCAGTAAAACTGTTCTGGG + Exonic
968915167 4:3494099-3494121 TTCCCCAGTGAAGCCCTTGTGGG + Exonic
972741270 4:41888957-41888979 TTCACCAGTGTAGAAGTTGTAGG + Intergenic
973701126 4:53538366-53538388 TTCACAGGGAAAGCTGTTCTAGG - Intronic
984077769 4:175205039-175205061 CTCTTCAGTAAAGCTGTTTTTGG - Intergenic
985583663 5:714640-714662 TTCAGCAGACAAGCTGTGGTTGG + Intronic
985597172 5:798937-798959 TTCAGCAGACAAGCTGTGGTTGG + Intronic
986769946 5:10963493-10963515 TGGACCAGTGAAGCAGTTGTTGG + Intergenic
989570125 5:42938261-42938283 TTCACCATGTTAGCTGTTGTGGG - Intergenic
992523683 5:77584124-77584146 TTCACCAGTGAGGTTGATGTTGG - Intronic
994341532 5:98635100-98635122 TTAAGCATTAAAGCTGTTCTTGG + Intergenic
994722705 5:103399546-103399568 TTCAGTAGTAAGGCTGTTCTTGG + Intergenic
997146694 5:131442249-131442271 TTCAGGAGATAAGCTGTTGTAGG - Intronic
997729226 5:136153796-136153818 TCCAGCAGTAAAGCGATTGTTGG + Exonic
1003262977 6:4539835-4539857 TTCACCAGTGAAGCCATTTTGGG - Intergenic
1006210297 6:32387699-32387721 TTCACCAGGAAAGCTGTCCTTGG + Intergenic
1013997666 6:116326975-116326997 TTCACCCATTAGGCTGTTGTTGG + Intronic
1014292430 6:119574696-119574718 TTCACCAGTGAAACTATTTTTGG - Intergenic
1015264487 6:131276894-131276916 GACATCAGTTAAGCTGTTGTTGG + Intronic
1015464196 6:133529803-133529825 TTCTCCAGTAAAACTGTAGAAGG - Exonic
1017701428 6:157076601-157076623 ATAAACAGTAAAGTTGTTGTGGG + Intronic
1022858579 7:34341687-34341709 TTAACCAGCAAAGGTGTTGAGGG + Intergenic
1023467138 7:40468703-40468725 TTTACCATTAAAGATTTTGTGGG + Intronic
1026021472 7:66710321-66710343 TTTACCAGTAAAGATGCTATAGG + Intronic
1033767796 7:144513722-144513744 TTCACCAGTTCAGCCTTTGTGGG - Intronic
1034505462 7:151486355-151486377 ATCACCAGTAGCACTGTTGTGGG + Intronic
1036008902 8:4698343-4698365 TTCACCAGTTTATCTGTTTTGGG - Intronic
1036394804 8:8360471-8360493 TTCACCAGGACAGATGATGTAGG - Intronic
1036406756 8:8462064-8462086 TTCAACAATTAAGCTGGTGTGGG + Intergenic
1037205665 8:16316765-16316787 CTCTCCAGTAAATCTTTTGTTGG - Intronic
1038079427 8:24116993-24117015 CTCAGCAGTAAAGCTGTCCTTGG - Intergenic
1041756007 8:61313749-61313771 CTCAACAGGAATGCTGTTGTTGG - Intronic
1041964766 8:63663153-63663175 TTCACCATTAAATTTGTTGTTGG + Intergenic
1043295411 8:78655989-78656011 TTCCAGAGTAAAGTTGTTGTAGG + Intergenic
1047773788 8:128052085-128052107 TTCACCAGTCAAGATATTTTGGG + Intergenic
1049008833 8:139874074-139874096 TGCACCAGTAAGGCTGCTCTGGG + Intronic
1056128419 9:83560631-83560653 CACACCAATTAAGCTGTTGTTGG + Intergenic
1056938271 9:90934582-90934604 CTCACCAGAAAAGATTTTGTGGG + Intergenic
1057109505 9:92454120-92454142 TTCACCAGAAAATGTGTTTTTGG + Intronic
1058110592 9:101028173-101028195 CGCCCCATTAAAGCTGTTGTGGG + Intergenic
1058563564 9:106256477-106256499 TTCACCATTAAACATGATGTTGG + Intergenic
1059144025 9:111881543-111881565 TTCACCATTAATTATGTTGTTGG - Intergenic
1060674805 9:125504052-125504074 TTCTCCAGTAAATCTGTTTTTGG - Intronic
1187911730 X:24117671-24117693 GTCTCCAGCAAAGCTGCTGTAGG - Intergenic
1188869186 X:35352815-35352837 TGCACCAGCAGAGCAGTTGTGGG - Intergenic
1190138392 X:47817919-47817941 TTTTCCAGTAAGGCTGTTGATGG + Intergenic
1190594538 X:52039429-52039451 TTCACCAGAAATGCTATTCTGGG - Intergenic
1193296496 X:79839726-79839748 TTCACAAGAAACACTGTTGTAGG + Intergenic
1195739557 X:108049863-108049885 TTCTCCAGTGAAGTTTTTGTTGG + Intronic
1197010260 X:121552461-121552483 TTCACCAGATATGCTATTGTAGG - Intergenic
1198436581 X:136622638-136622660 TTCCAAAGTATAGCTGTTGTTGG - Intergenic
1199404298 X:147438358-147438380 TTCCCCAGGAAAGGTTTTGTAGG - Intergenic
1200923637 Y:8635086-8635108 TTTTCCAGTAATGCTGTTGAAGG - Intergenic
1200962176 Y:9005771-9005793 TTGTCCAGTAGAGCTGTTGAAGG - Intergenic
1201379692 Y:13361161-13361183 TGTACCAGTAAAGATATTGTAGG - Intronic