ID: 1179949750

View in Genome Browser
Species Human (GRCh38)
Location 21:44703043-44703065
Sequence CCATAGCCACAGGAGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179949741_1179949750 4 Left 1179949741 21:44703016-44703038 CCGGGTGTTCCCTGGTGGAATAT 0: 1
1: 0
2: 2
3: 10
4: 111
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949742_1179949750 -5 Left 1179949742 21:44703025-44703047 CCCTGGTGGAATATTCCCCCATA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949732_1179949750 27 Left 1179949732 21:44702993-44703015 CCCTCTCCTATTATTGAAGGGCC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949733_1179949750 26 Left 1179949733 21:44702994-44703016 CCTCTCCTATTATTGAAGGGCCC 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949743_1179949750 -6 Left 1179949743 21:44703026-44703048 CCTGGTGGAATATTCCCCCATAG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949736_1179949750 21 Left 1179949736 21:44702999-44703021 CCTATTATTGAAGGGCCCCGGGT 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949739_1179949750 6 Left 1179949739 21:44703014-44703036 CCCCGGGTGTTCCCTGGTGGAAT 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155
1179949740_1179949750 5 Left 1179949740 21:44703015-44703037 CCCGGGTGTTCCCTGGTGGAATA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179949750 Original CRISPR CCATAGCCACAGGAGGTCCC TGG Intronic
900391886 1:2437151-2437173 GCAAGGCCACAGCAGGTCCCCGG + Intronic
900539026 1:3193608-3193630 TCTGAGCCACAGGAGCTCCCTGG - Intronic
901204923 1:7489150-7489172 CCTTTGCCACAGGTGGGCCCTGG + Intronic
901482655 1:9536593-9536615 ACACAGCCCCAGGAGGTCCTGGG + Intergenic
901681097 1:10913280-10913302 CCCTGGCCACAGGAGGTCAAGGG + Intergenic
904787755 1:32995467-32995489 CAATAGCCAAAGGATGTGCCAGG - Intergenic
906257221 1:44359494-44359516 TCATGGCAACAGGAAGTCCCTGG + Intergenic
907291888 1:53419878-53419900 CCATAGGCACAGAAGGTACAGGG - Intergenic
915592897 1:156880592-156880614 CCACAGCCAGAGCAGGCCCCAGG + Intronic
915894944 1:159804539-159804561 CTATAGCTAATGGAGGTCCCTGG + Intronic
915980557 1:160417320-160417342 CCATATCCCCAGGCTGTCCCAGG + Intronic
918145502 1:181752523-181752545 ACATAGACATAGGAGGCCCCAGG - Intronic
920212803 1:204340674-204340696 CCAGAGCCATAGCAGCTCCCAGG - Intronic
922526443 1:226308492-226308514 CCACAGCCACCTGTGGTCCCAGG + Intronic
1067064031 10:43093667-43093689 CCAAAGACAGAGGAGGTCCTGGG + Intronic
1069241331 10:66143736-66143758 CCTTAACCGCAGGTGGTCCCAGG + Intronic
1069844101 10:71358725-71358747 CTAGAGCCAAAGGAGCTCCCAGG + Intronic
1070419021 10:76218068-76218090 CCATTGCCACTGAATGTCCCTGG - Intronic
1071298512 10:84239853-84239875 CCATAGCCACAGGGGACCTCAGG + Intronic
1073511181 10:104043528-104043550 CCATGGCTCCAGGAGGTCCTGGG + Exonic
1076663120 10:132068632-132068654 CCTTAGCCCCAGGAGCTGCCTGG + Intergenic
1076717534 10:132374115-132374137 CCATAATCACAGCAGGTCCCTGG - Intronic
1076717556 10:132374212-132374234 ACATAATCACAGCAGGTCCCTGG - Intronic
1076732800 10:132446818-132446840 CCAGAGCCACAGCAGGGGCCTGG + Intronic
1076753616 10:132556194-132556216 ACAAAGCCACAGGAGGACACAGG - Intronic
1077252621 11:1567286-1567308 CCACAGCCACAGGAGGCACTGGG + Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1077530686 11:3093419-3093441 GCATGGCCCCAGGATGTCCCTGG - Intronic
1079025337 11:16943350-16943372 CCATAGCCACATGTGGTCAGTGG + Intronic
1082256828 11:50041418-50041440 CCATCTCCACAGGAGATCCTTGG + Intergenic
1084941221 11:72614458-72614480 CTCTAGCCACAGGAGGTGCTTGG - Intronic
1085197174 11:74679753-74679775 CCAGAGCCTGAGGAGGCCCCTGG - Intergenic
1088509589 11:110560942-110560964 CCATGGCCACAGGGGGCACCAGG - Intergenic
1089654381 11:119936109-119936131 CCACACCCACAGGAGCTTCCTGG + Intergenic
1089727662 11:120496807-120496829 CCATAGCCACTGCAGGTTCTTGG - Intergenic
1090393792 11:126406237-126406259 CCACAGCCCCCAGAGGTCCCAGG - Intronic
1090416577 11:126544534-126544556 CCATAGCCCCAGGTAGCCCCGGG - Intronic
1099205565 12:79722197-79722219 CCGTAGCCACAGAGGGTCCCAGG - Intergenic
1099545168 12:83970340-83970362 ACACAGCCTCAGGAGGTCCTGGG + Intergenic
1101446367 12:104739427-104739449 CTATAACCACAGGAGGTCCGTGG + Intronic
1102580166 12:113881376-113881398 CCGTAGCCAGAGGAGGCCCACGG + Intronic
1103736671 12:123065078-123065100 CCACAGCCGCTGGAGGCCCCTGG + Intronic
1104852821 12:131885988-131886010 ACACAGCCTCAGGGGGTCCCGGG + Intergenic
1104904782 12:132207403-132207425 CCAGCGCCACAGAAGGCCCCGGG - Intronic
1107909670 13:45093548-45093570 CCAAAGTCACAGGAGTTCCTGGG + Intergenic
1110333599 13:74300950-74300972 CCTAAGCCAAAGGATGTCCCAGG - Intergenic
1110801429 13:79701160-79701182 TCAAATCCACAGCAGGTCCCAGG + Intergenic
1113577741 13:111405801-111405823 CCAAAGTCATAGGCGGTCCCCGG - Intergenic
1116380448 14:44261621-44261643 GCATTGCCACCGGGGGTCCCTGG - Intergenic
1122615449 14:103014660-103014682 CAAGAGCCACAGAAGGTTCCAGG + Intronic
1126498564 15:49319731-49319753 CCAGAGCCACATGAGCTGCCGGG + Exonic
1128543474 15:68552450-68552472 CCATGGCCATAGGAGGACGCGGG + Intergenic
1132141102 15:99396538-99396560 CCACAGCGACAGCAGTTCCCTGG - Intergenic
1137830503 16:51539194-51539216 TCATAACCACAGAACGTCCCAGG + Intergenic
1137935431 16:52630799-52630821 CCTTATCCACAGCAAGTCCCTGG + Intergenic
1139448209 16:67011627-67011649 GCATAGCCGGAGGATGTCCCAGG + Intergenic
1141409273 16:83821470-83821492 CCATAGACACAGGGGGACTCTGG - Intergenic
1142168515 16:88606980-88607002 CACTAGCAATAGGAGGTCCCTGG - Intronic
1142656801 17:1399887-1399909 CCATCGCCCCGGGAGCTCCCAGG + Intronic
1142860307 17:2756741-2756763 CCAGAGCCACGGGAGGTGCTGGG - Intergenic
1143917288 17:10303175-10303197 CGGTAAGCACAGGAGGTCCCCGG - Exonic
1146065566 17:29632195-29632217 CCAGATCCTCAGGAGGGCCCAGG - Exonic
1148859958 17:50599640-50599662 CCATCGCCACAGGGGGTCCCTGG + Exonic
1148997980 17:51728645-51728667 CAATATCCACAAGACGTCCCTGG + Intronic
1151209933 17:72537047-72537069 CCATAGCAAAATCAGGTCCCAGG + Intergenic
1152261889 17:79271843-79271865 CTAGAGGCACAGGAGTTCCCCGG + Intronic
1152262767 17:79275835-79275857 CCAGAGCCACCGGAGGACCCAGG + Intronic
1152661301 17:81543536-81543558 TCACAGCCCCAGGAGTTCCCTGG - Intronic
1153771920 18:8423452-8423474 CCATGGCCACAGCAGCCCCCGGG + Intergenic
1154076107 18:11203382-11203404 CCATGTCCAGAGCAGGTCCCTGG + Intergenic
1157504261 18:48215350-48215372 ACACAGCCTCAGGAGGTCCTGGG + Intronic
1161138909 19:2636658-2636680 CCAAAACCAGAGGCGGTCCCTGG - Intronic
1161501777 19:4620173-4620195 TCAAAGCCGCAGGGGGTCCCAGG - Intergenic
1162473719 19:10887546-10887568 CCAGAGACACAGGATGTCCTGGG - Intronic
1162489719 19:10984991-10985013 CACGGGCCACAGGAGGTCCCGGG + Intronic
1163584628 19:18157085-18157107 CCAAAGCCCCGGGAGGTGCCAGG + Intronic
1167748302 19:51365757-51365779 CCATAGCCACAGGGTGAGCCAGG - Intronic
1167937635 19:52920865-52920887 ACACAGCCTCAGGGGGTCCCAGG - Intergenic
1168436254 19:56319773-56319795 CCATAGTTACAGGAGGGACCGGG - Intronic
1168703587 19:58455533-58455555 CCATGTGCACAGGAGGTCCCTGG + Exonic
1168706092 19:58471081-58471103 CCATGTGCACAGGAGGTCCCTGG + Exonic
927434046 2:23052126-23052148 TCATAGCCACAGGCAGTACCAGG - Intergenic
929118878 2:38467454-38467476 CCATAGGAAAAGGAGGTCCCGGG + Intergenic
932334332 2:70921328-70921350 TCATATCCCCAGGAGTTCCCAGG - Intronic
933270945 2:80232234-80232256 ACATAGCCTCAGGAGGTCCTGGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936373954 2:111925120-111925142 ACAGAGCCACAGTGGGTCCCAGG - Intronic
938421054 2:131147246-131147268 CCATAGCCTCGGGAAGTACCTGG - Exonic
943434470 2:187847529-187847551 CCATAGCAACTGAAGCTCCCAGG - Intergenic
944174891 2:196818287-196818309 CCATAGAGAAAGGAGGCCCCAGG + Intergenic
944318383 2:198307566-198307588 TCATAGGCAAAGGAGGTCACAGG + Intronic
948314490 2:237016882-237016904 CCAGAGACTCAGGGGGTCCCAGG - Intergenic
948525525 2:238568563-238568585 CCACAGGCACTGAAGGTCCCAGG + Intergenic
948837264 2:240631787-240631809 CCACACTCACAGGAGGTCTCTGG - Intergenic
948890448 2:240904782-240904804 CCATGGCCACAGGGCCTCCCAGG + Intergenic
1171344095 20:24452629-24452651 CCAGAGCCACAGGTGGCACCGGG + Intergenic
1172354277 20:34268905-34268927 CCCTAGCCCGAGGAGCTCCCAGG + Intronic
1175089580 20:56490910-56490932 CCACAGCCACAGGGGCTCCTGGG - Intronic
1175687748 20:61043949-61043971 CCAGAGCCACCGAAGGCCCCAGG + Intergenic
1175753173 20:61513223-61513245 CAATAGCAACAGGAAGTCCCTGG - Intronic
1179385420 21:40937289-40937311 TCAGAACCACAGGTGGTCCCCGG + Intergenic
1179949750 21:44703043-44703065 CCATAGCCACAGGAGGTCCCTGG + Intronic
1182357794 22:29730083-29730105 GCATAGCCTGAGGAGGCCCCTGG + Exonic
1183302778 22:37066433-37066455 CCACAGTTCCAGGAGGTCCCAGG - Intronic
1183663891 22:39236410-39236432 CGATGGCCTCAGGAGGCCCCAGG + Intronic
1184552432 22:45211588-45211610 CCATGGCCAAGGGAGGGCCCTGG + Intronic
952866477 3:37858507-37858529 TCATAGCCAAAGGCTGTCCCTGG - Intergenic
953627069 3:44580129-44580151 CCCCAACCACAGGAGGTCCCAGG - Intronic
956813968 3:72890905-72890927 CAAAAGCCACAGGAAGTCTCAGG + Intronic
958728797 3:97937959-97937981 CAAAAGCCACAGGCAGTCCCTGG + Intronic
960113445 3:113868756-113868778 CCAAAGACACAAGAGGTCTCAGG - Intronic
960619292 3:119623471-119623493 CCAGAGGGACAGCAGGTCCCAGG + Intronic
961109432 3:124271391-124271413 CCATAGCTCCAGAAGTTCCCAGG + Intronic
961731195 3:128966227-128966249 CCATAGCCACATGAGGGTACTGG - Intronic
962391853 3:134978780-134978802 CCAGAGCCACAGGAGCAACCTGG - Intronic
963079405 3:141377019-141377041 CCAAAGCTACAGGAAGACCCTGG + Intronic
963801708 3:149682915-149682937 CCAGAGCCACAGGAGGTTCAAGG - Intronic
964314121 3:155425162-155425184 CCATAGGCAGAGCAGCTCCCAGG + Intronic
968816222 4:2823249-2823271 ACAAAGCCACAGGAAGACCCTGG - Intronic
969759888 4:9174146-9174168 CCAGAGCCAAAGGAGCTCCTGGG - Intronic
971238877 4:24869371-24869393 GAATAGCCACAGCAGGGCCCAGG - Intronic
973574128 4:52268816-52268838 ACACAGCCCCAGGAGATCCCAGG - Intergenic
975313335 4:72926778-72926800 CCATTGGCTGAGGAGGTCCCAGG + Intergenic
976190062 4:82478960-82478982 CCATTGGCTGAGGAGGTCCCAGG - Intergenic
977553525 4:98466653-98466675 CCATAGACAGAGGAGTTCTCAGG + Intergenic
984172856 4:176381520-176381542 CCATGGCCACATGAGGCCCAGGG + Intergenic
989807269 5:45624768-45624790 CCATAAACACAAGAGGGCCCAGG - Intronic
992802160 5:80303463-80303485 ACACAGCCTCAGGAGGTCCTGGG + Intergenic
995682902 5:114740652-114740674 CAATAGCCACACAAGGTCCATGG - Intergenic
997118087 5:131147638-131147660 GCAGAGCCACAGAAGTTCCCTGG + Intergenic
998171346 5:139873633-139873655 CAACACCCACAGGAGGGCCCAGG - Intronic
999692199 5:154157807-154157829 CCTTAGCCACTGGAGGGCCAAGG + Intronic
1001103723 5:168835142-168835164 TCCTAGCCACAGGCGGGCCCAGG + Intronic
1002840729 6:903082-903104 CCCCAGCCTCAGAAGGTCCCTGG - Intergenic
1003254662 6:4464421-4464443 ACACTGCCACAGGAGTTCCCAGG + Intergenic
1007360588 6:41352602-41352624 CCATAACCACAGGAAGTCCCTGG - Intergenic
1013375756 6:109512375-109512397 CCATAGACACAGCAGCCCCCAGG - Intronic
1014655981 6:124104796-124104818 TAATAGCCACGGGAGGTCACTGG + Intronic
1017905818 6:158757039-158757061 CCCTAACCACATCAGGTCCCTGG + Intronic
1019068282 6:169321082-169321104 ACACAGCCCCAGGAGGTCCTGGG - Intergenic
1019735402 7:2647750-2647772 CCAGGGCCACTGGAGGTCACAGG + Intronic
1023598400 7:41856433-41856455 TCGCAGCCACAGGAGGTCACTGG + Intergenic
1023852583 7:44158601-44158623 ACATAGCCACCTGAGGGCCCAGG - Intronic
1023878883 7:44307486-44307508 CCAATGACACAGGAGGCCCCAGG - Intronic
1027867768 7:83669600-83669622 CAATAGCAACAGGAGGTAGCTGG + Intergenic
1036210840 8:6839946-6839968 CAGTAGCCACATAAGGTCCCAGG + Intergenic
1037875474 8:22545017-22545039 CCATACCCACAGATGGGCCCTGG - Intronic
1038678159 8:29642400-29642422 CCAGAGAGACAGGAGTTCCCAGG - Intergenic
1038764435 8:30414290-30414312 CCACAGATACAGGAGGTCCAAGG - Intronic
1039297669 8:36174455-36174477 CCATGGCCAGAGGAGGTATCTGG + Intergenic
1042436855 8:68775990-68776012 CCACCACCACAGCAGGTCCCAGG - Intronic
1042659604 8:71140160-71140182 ACATATCCACAGGACGCCCCTGG - Intergenic
1045253146 8:100497900-100497922 CCATAGGCACAGCAGCTTCCAGG + Intergenic
1046980651 8:120332723-120332745 GCATACTCACAGGTGGTCCCAGG - Exonic
1049327361 8:142029869-142029891 CCAGAGCCAGAGGAGGACCCCGG - Intergenic
1049676220 8:143890465-143890487 CCCTTCCCACAGGAGGTTCCAGG - Intergenic
1051151242 9:14081405-14081427 CCACAGCCACAGGGTGTCCCCGG + Intergenic
1053306075 9:36985771-36985793 CCCAAGCCACAGCAGGTCACTGG + Intronic
1057291115 9:93808047-93808069 CCACAGCCACAGAAGGTGGCTGG + Intergenic
1058948554 9:109881704-109881726 CTATAGCCACTCCAGGTCCCAGG + Intronic
1060530413 9:124344372-124344394 CGGTGGCCACAGGAGGTCCTCGG - Intronic
1060753581 9:126191857-126191879 CAAGAGCCCCAGGAGGTCACTGG - Intergenic
1060901172 9:127259482-127259504 TCATGGCAACAGGGGGTCCCAGG + Intronic
1062525234 9:136975608-136975630 CCATAGCCAGAGGGGTTCCCAGG - Intergenic
1186115994 X:6305861-6305883 CCATAGGCACAGCAGCTCCGAGG + Intergenic
1190067121 X:47249064-47249086 CCATCTCCAAAGGAGGTCTCAGG - Intergenic
1190988445 X:55521841-55521863 CCATAGCCTCTGGAGGTGCTAGG + Intergenic
1192547545 X:72026558-72026580 CCACAGCCAGAGGCTGTCCCAGG + Intergenic
1195674386 X:107496806-107496828 CCACAGCCACCTGAGGTCCTGGG + Intergenic
1196274005 X:113744992-113745014 CCAAAGCCACAGCAAATCCCAGG - Intergenic
1197684849 X:129427998-129428020 TCCTAGCCACAGGAGAGCCCTGG - Intergenic
1197730469 X:129805224-129805246 CCATAGCCAGAGGTGGGCCGAGG + Exonic