ID: 1179951850

View in Genome Browser
Species Human (GRCh38)
Location 21:44712666-44712688
Sequence CGGCCTCAGACCAGTTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179951850_1179951854 -1 Left 1179951850 21:44712666-44712688 CCTGGCAAACTGGTCTGAGGCCG No data
Right 1179951854 21:44712688-44712710 GATGGCTTTCCCTGGTTCACAGG No data
1179951850_1179951852 -9 Left 1179951850 21:44712666-44712688 CCTGGCAAACTGGTCTGAGGCCG No data
Right 1179951852 21:44712680-44712702 CTGAGGCCGATGGCTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179951850 Original CRISPR CGGCCTCAGACCAGTTTGCC AGG (reversed) Intergenic
No off target data available for this crispr