ID: 1179953411

View in Genome Browser
Species Human (GRCh38)
Location 21:44724207-44724229
Sequence CAGAATACTTGGAGGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179953411_1179953419 30 Left 1179953411 21:44724207-44724229 CCAGACTGCCTCCAAGTATTCTG No data
Right 1179953419 21:44724260-44724282 CTTAAGGTGTTTTTAAAACCCGG No data
1179953411_1179953415 -10 Left 1179953411 21:44724207-44724229 CCAGACTGCCTCCAAGTATTCTG No data
Right 1179953415 21:44724220-44724242 AAGTATTCTGGCCTCCATATTGG No data
1179953411_1179953418 14 Left 1179953411 21:44724207-44724229 CCAGACTGCCTCCAAGTATTCTG No data
Right 1179953418 21:44724244-44724266 GTGCTACGCTTGTTATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179953411 Original CRISPR CAGAATACTTGGAGGCAGTC TGG (reversed) Intergenic
No off target data available for this crispr