ID: 1179958691

View in Genome Browser
Species Human (GRCh38)
Location 21:44756047-44756069
Sequence ATGGAGAAGAAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179958684_1179958691 25 Left 1179958684 21:44755999-44756021 CCTGTCTCACACACACAAAAACA No data
Right 1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG No data
1179958683_1179958691 26 Left 1179958683 21:44755998-44756020 CCCTGTCTCACACACACAAAAAC No data
Right 1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179958691 Original CRISPR ATGGAGAAGAAGAGGGAGGA GGG Intergenic
No off target data available for this crispr