ID: 1179960049

View in Genome Browser
Species Human (GRCh38)
Location 21:44763023-44763045
Sequence TTGTGAAGTTCTCTATCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179960049_1179960051 2 Left 1179960049 21:44763023-44763045 CCGAGAGATAGAGAACTTCACAA No data
Right 1179960051 21:44763048-44763070 GAGCAGGCCAAATGCTTTGCTGG No data
1179960049_1179960053 28 Left 1179960049 21:44763023-44763045 CCGAGAGATAGAGAACTTCACAA No data
Right 1179960053 21:44763074-44763096 TGCTCCAAAGACGCCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179960049 Original CRISPR TTGTGAAGTTCTCTATCTCT CGG (reversed) Intergenic