ID: 1179960052

View in Genome Browser
Species Human (GRCh38)
Location 21:44763055-44763077
Sequence AGCAGTTCCAGCAAAGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179960052_1179960053 -4 Left 1179960052 21:44763055-44763077 CCAAATGCTTTGCTGGAACTGCT No data
Right 1179960053 21:44763074-44763096 TGCTCCAAAGACGCCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179960052 Original CRISPR AGCAGTTCCAGCAAAGCATT TGG (reversed) Intergenic