ID: 1179960052 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:44763055-44763077 |
| Sequence | AGCAGTTCCAGCAAAGCATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1179960052_1179960053 | -4 | Left | 1179960052 | 21:44763055-44763077 | CCAAATGCTTTGCTGGAACTGCT | No data | ||
| Right | 1179960053 | 21:44763074-44763096 | TGCTCCAAAGACGCCCCCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1179960052 | Original CRISPR | AGCAGTTCCAGCAAAGCATT TGG (reversed) | Intergenic | ||