ID: 1179960730

View in Genome Browser
Species Human (GRCh38)
Location 21:44765863-44765885
Sequence CAACATGCATGGCCACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179960727_1179960730 -3 Left 1179960727 21:44765843-44765865 CCACACTTGTGGGAGGCAGACAA No data
Right 1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG No data
1179960718_1179960730 25 Left 1179960718 21:44765815-44765837 CCACCCAGCTGGGGGCAGGGCCG No data
Right 1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG No data
1179960719_1179960730 22 Left 1179960719 21:44765818-44765840 CCCAGCTGGGGGCAGGGCCGCAG No data
Right 1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG No data
1179960720_1179960730 21 Left 1179960720 21:44765819-44765841 CCAGCTGGGGGCAGGGCCGCAGG No data
Right 1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG No data
1179960725_1179960730 5 Left 1179960725 21:44765835-44765857 CCGCAGGGCCACACTTGTGGGAG No data
Right 1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179960730 Original CRISPR CAACATGCATGGCCACTGCA GGG Intergenic
No off target data available for this crispr