ID: 1179963850

View in Genome Browser
Species Human (GRCh38)
Location 21:44788757-44788779
Sequence GTGGGCAACCAGAGTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179963848_1179963850 -8 Left 1179963848 21:44788742-44788764 CCAGGCTGGAGTCCAGTGGGCAA 0: 1
1: 51
2: 487
3: 5539
4: 105792
Right 1179963850 21:44788757-44788779 GTGGGCAACCAGAGTGAGACTGG 0: 1
1: 0
2: 0
3: 20
4: 176
1179963847_1179963850 -7 Left 1179963847 21:44788741-44788763 CCCAGGCTGGAGTCCAGTGGGCA 0: 2
1: 116
2: 1146
3: 17461
4: 280352
Right 1179963850 21:44788757-44788779 GTGGGCAACCAGAGTGAGACTGG 0: 1
1: 0
2: 0
3: 20
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179963850 Original CRISPR GTGGGCAACCAGAGTGAGAC TGG Intronic
900140215 1:1136714-1136736 GTGGGCAAATGAAGTGAGACCGG - Intergenic
900992166 1:6103172-6103194 GTGGGCTACTAGAGTCAGAGCGG - Exonic
901174265 1:7287215-7287237 GTGAGCAGCCAGGGGGAGACAGG + Intronic
901410203 1:9077718-9077740 CTGGGCAACAAGGGTGAAACAGG + Intronic
901752473 1:11419209-11419231 GGGAGCAACCAGAGAGAGACAGG - Intergenic
901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG + Intronic
904526948 1:31140875-31140897 CTGGGCAACAAGAGAGAAACAGG + Intergenic
904935324 1:34126083-34126105 GTGGGCAACTGGAGTGGGTCTGG - Intronic
906336241 1:44934095-44934117 CTGGGCAACAAGAGTGAAACAGG + Intronic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
910660102 1:89662448-89662470 GTGAGCAACCAGAATGATCCTGG - Intronic
911147502 1:94567003-94567025 GTGGGAAACTAGAGTGGGAGAGG + Intergenic
911347990 1:96720579-96720601 CTGGGCAACAAGAGCGAGACTGG + Intergenic
912249242 1:107993656-107993678 GTTGGCAACCGGAATGAGAGGGG - Intergenic
914928129 1:151906518-151906540 GTGGGCACACAGCGTGGGACTGG + Intronic
917311536 1:173684158-173684180 GTAGGTAATCAGAATGAGACAGG + Intergenic
919978083 1:202625747-202625769 GTGGGCAACCGGTGGGAGGCCGG + Intronic
921049338 1:211499973-211499995 GAGTGCAAGGAGAGTGAGACAGG - Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
924696111 1:246401745-246401767 CTGGGCAACAAGAGTGAAACTGG - Intronic
924953967 1:248909801-248909823 GTAGGGAACCTGAGGGAGACAGG + Intronic
1064722220 10:18240872-18240894 GTGGGAAACAAGAGCGAGAGAGG - Intronic
1064749453 10:18511776-18511798 GAGGGCACCCAGATTGAGAAGGG + Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067295499 10:44973197-44973219 GGGGGCAGGCAGGGTGAGACAGG - Intronic
1069118578 10:64539062-64539084 TTGGTCAATCAGAGGGAGACAGG - Intergenic
1069777956 10:70937764-70937786 GTGGTCACCCAGAGGGAGAGTGG - Intergenic
1072276586 10:93829265-93829287 GTGGCCAAACAGATAGAGACAGG - Intergenic
1072539557 10:96387952-96387974 GTGGCCTACCAGAGCGAGAAAGG + Intronic
1075044636 10:119136687-119136709 GTGGGTAATCAGAGTGAAAGAGG - Exonic
1080185988 11:29487194-29487216 GTTGGCAATCAGAGTGAGTTAGG - Intergenic
1080484479 11:32691067-32691089 CTGGGGGACAAGAGTGAGACTGG - Intronic
1080797240 11:35576099-35576121 GTGGACAAACAGAGAGACACCGG - Intergenic
1081504799 11:43704899-43704921 GTGGGCAAACTGAGTGGGTCAGG - Intronic
1084728277 11:71056285-71056307 GTGAGCAAGCACACTGAGACGGG + Intronic
1085022645 11:73218874-73218896 GTGGCCACCCAGAGTGACCCTGG - Intronic
1089716011 11:120359952-120359974 GTGGGGAACCAGAGAAAGATTGG + Intronic
1090378457 11:126308206-126308228 GTTGGAAACATGAGTGAGACTGG + Intronic
1091104602 11:132906845-132906867 TTTAGCAACCAGAGTGAGGCTGG + Intronic
1091165755 11:133474696-133474718 GAGGGCAACCAGAGTGAGCTGGG - Intronic
1091372797 11:135074810-135074832 GTGTGCCACCAGAGAGTGACAGG - Intergenic
1091783039 12:3225806-3225828 GTGGGCCACCAGGCTGAGAGAGG + Intronic
1097241784 12:57580628-57580650 GGGGGAAACCAGATGGAGACAGG + Intronic
1098389710 12:69956605-69956627 CTGGGCAAGCAGAGGGAGAGAGG - Intronic
1100221127 12:92505557-92505579 CTGGGGAACCAGTGTGACACTGG + Intergenic
1105543002 13:21330995-21331017 CTGGGGAACCAGCCTGAGACAGG - Intergenic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1106029889 13:25990521-25990543 GTGGGAAACCAGAGTGATCCAGG + Intronic
1106111724 13:26783456-26783478 GGGGGCTCCCAGAGTGAGGCAGG - Intergenic
1107829567 13:44362393-44362415 GAGGCCAACGAGAGAGAGACTGG - Intergenic
1108769648 13:53683848-53683870 GTGGAAAACCACAGTGAAACTGG - Intergenic
1112574977 13:100627470-100627492 ATGGGCAAGCACCGTGAGACAGG - Intronic
1113135186 13:107080952-107080974 GTGAGGAACCAGAGAGAGAGAGG - Intergenic
1113731387 13:112644220-112644242 GTGTAGAGCCAGAGTGAGACGGG + Intergenic
1114257636 14:21016923-21016945 GTGTGCATCTAGAGTGGGACTGG - Exonic
1114651881 14:24290366-24290388 GTGGAAAACCAGTGTGAGACTGG + Intergenic
1120960990 14:90124632-90124654 GTGGGCAACCTGAATGAGCAAGG + Intronic
1121121367 14:91377790-91377812 AGGGGCAACCAGACAGAGACTGG - Intronic
1122552760 14:102558898-102558920 GTGGGGAGCCAGGGTGAGGCTGG - Intergenic
1123888271 15:24749044-24749066 GTGGGCACCCAGAGTGGGGAGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124493695 15:30173687-30173709 GTGGGCAACCGGTGGGAGGCCGG + Intergenic
1124749872 15:32364962-32364984 GTGGGCAACCGGTGGGAGGCCGG - Intergenic
1124859287 15:33422635-33422657 GTGGGCAAGCAGAGAGAGAGAGG + Intronic
1134121421 16:11587075-11587097 GGGGGCGATCAGAGTGAGGCGGG - Intronic
1134406331 16:13962220-13962242 GTGGGGAATGGGAGTGAGACTGG - Intergenic
1135751289 16:25060353-25060375 CTGGGCAACAAGAGCGAAACTGG + Intergenic
1135875587 16:26197020-26197042 GTGGGCTACCAGAGAAAGGCAGG - Intergenic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1140359280 16:74330973-74330995 GTGGGAAACCTCAGTGTGACTGG + Intergenic
1142616540 17:1139720-1139742 GTGGGAAACCAGATGGACACAGG + Intronic
1147524922 17:41213371-41213393 CTGGGCAACAAGAGCGAAACTGG - Intronic
1155308081 18:24498608-24498630 GAGGGCACCCAGAGAGGGACGGG + Intergenic
1155598775 18:27518933-27518955 TTGGGCAACAAGAGTGAAACTGG - Intergenic
1159752763 18:72323123-72323145 TTGGGCAACAAGAGAGAAACTGG + Intergenic
1163640327 19:18458357-18458379 GTGGGAATCCTGAGAGAGACGGG + Intronic
1164455358 19:28402374-28402396 ATGGGGAGCCAGCGTGAGACAGG - Intergenic
1166192400 19:41183714-41183736 GTGGGCAGGCAGAGTGAGCCTGG + Intergenic
1167411161 19:49344697-49344719 CTTAGCAACCAGAGTGAGAGGGG - Intronic
1168271706 19:55253488-55253510 AGGGGCAGCCAGAATGAGACGGG + Intronic
925793486 2:7518052-7518074 GTGGGTGACAAGAGTGAGAGAGG + Intergenic
926742814 2:16126291-16126313 GTGGGTAACCAGAGTCACTCTGG - Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
927098376 2:19765673-19765695 GTGGGAATCCAGGCTGAGACTGG + Intergenic
931266178 2:60662236-60662258 GTGGGCAACATGTGTGAGCCAGG - Intergenic
934167790 2:89310522-89310544 CTGGGCAACAAGAGCGAAACTGG + Intergenic
934199497 2:89872061-89872083 CTGGGCAACAAGAGCGAAACTGG - Intergenic
935637531 2:105261238-105261260 GTGGGCAACCAGACAGAGGCAGG + Intergenic
936865481 2:117072064-117072086 GTGGGCACCCAGAGGGAGCGAGG + Intergenic
937052872 2:118906577-118906599 GTGGGCTCCAAGAGAGAGACAGG - Intergenic
939141637 2:138360982-138361004 CTGGGCGACAAGAGTGAAACTGG - Intergenic
945021203 2:205573300-205573322 GTGGGCATCAAGAGAAAGACTGG + Intronic
948136945 2:235643404-235643426 CTGGGCAACAAGAGAGAGACTGG + Intronic
948322505 2:237081956-237081978 ATGGGCAACCAGTGTGAAACTGG + Intergenic
1171416749 20:24986691-24986713 GTGGGCAACCAGATGGAACCAGG + Intronic
1172354099 20:34267432-34267454 GAGGGCGACAAGAGTGAAACTGG + Intronic
1172373533 20:34416371-34416393 CTGGGCAACAAGAGCGAAACTGG + Intronic
1173054584 20:39598772-39598794 GATGGCAACCAGTGTGAGAAGGG - Intergenic
1173561092 20:44006263-44006285 GTGGGAAACCAGAGAGGAACAGG + Intronic
1173811283 20:45957413-45957435 GTGGGCAAACAGAGAGGAACAGG - Intronic
1175165413 20:57040286-57040308 GAGGGAGACCAGTGTGAGACTGG + Intergenic
1175387358 20:58605862-58605884 GAGGGAAGCCAGAGTGAGCCCGG - Intergenic
1178686258 21:34713008-34713030 GAGGGCAAAGGGAGTGAGACAGG - Intronic
1179514522 21:41897588-41897610 GTGGGCAAACAGAGTCCAACGGG + Intronic
1179963850 21:44788757-44788779 GTGGGCAACCAGAGTGAGACTGG + Intronic
1181089156 22:20460201-20460223 GTCTGCAACCAGAGTGAGATAGG + Intronic
1182666533 22:31964330-31964352 GTGGGAAACCAGTGTGGGGCTGG + Intergenic
1185408169 22:50667979-50668001 CTGGGCAACAAGAGTGGAACTGG + Intergenic
951235891 3:20236087-20236109 CTGGGCAACAAGAGCGAAACTGG - Intergenic
951699902 3:25485769-25485791 GAAGGGAACCAGAGTGAGAGAGG - Intronic
952771786 3:37008005-37008027 CTGGGCAACAAGAGTGAAACAGG + Intronic
953391954 3:42539120-42539142 GAGGGAAACCAGAGAGAGAGAGG - Intergenic
954215031 3:49119981-49120003 ATGGGCATCCAGTTTGAGACTGG + Intronic
955379304 3:58423916-58423938 GTGGGCAAGGAGAGGGAAACTGG - Intronic
957038551 3:75317581-75317603 GTGGGCAGCCAGAGTCTGAATGG - Intergenic
959630198 3:108499047-108499069 GTGGGCAGCCAGATTGGGGCAGG - Intronic
960583583 3:119300990-119301012 TTGGGCTCCCAGAGTGAAACAGG + Intronic
960885562 3:122390593-122390615 GTGGTCAGCCAGGGTGAGGCTGG - Intronic
960973414 3:123154957-123154979 GTGGGCACCCTGTGTGAGAGGGG - Exonic
961086580 3:124072879-124072901 GTGGGCAGCCAGAGTCTGAATGG - Intergenic
964116007 3:153137074-153137096 CTGGGCAACAAGAGTGAAACTGG - Intergenic
964443164 3:156732875-156732897 GTGGGCACCCAGAGTAGGAATGG + Intergenic
967109893 3:186283978-186284000 GAAGGCAAACAGAGTCAGACAGG - Intronic
967189809 3:186975552-186975574 GTGGACAGGCAGAGGGAGACTGG - Intronic
967382333 3:188872946-188872968 GTGAGCAAGCAGACTGAGAGAGG - Intronic
968347044 3:198017368-198017390 TTGGGAAACCAGGGTGAGAAGGG + Intronic
969834625 4:9830570-9830592 GTGCCTAAGCAGAGTGAGACGGG - Intronic
971164138 4:24164854-24164876 GCGGGCAAGCAGATTGAGATGGG + Intergenic
973625148 4:52764279-52764301 CTGAGCAAACATAGTGAGACAGG - Intergenic
977283396 4:95070072-95070094 CTGGGCAACAAGAGAGAAACTGG + Intronic
980513779 4:133826388-133826410 GTGTCCACCCAGATTGAGACTGG - Intergenic
980574308 4:134665848-134665870 GTGGGCAACAAGAAGGAGAAAGG - Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984400701 4:179260511-179260533 GTGCCCAACCAGATTGAGAGTGG - Intergenic
986902661 5:12456142-12456164 CTGGGCAACAAGAGTGAAACTGG - Intergenic
989245561 5:39250258-39250280 GAGGGCAGGCAGAGTGAGAGAGG + Intronic
990182049 5:53172444-53172466 ATGGGCAACAAGAGTGAAACAGG - Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
991958781 5:72021298-72021320 TTGGGCAGGCAGAGTGAGAAGGG + Intergenic
992775398 5:80084532-80084554 CTGGGCAATGAGAGTGAGGCTGG + Intergenic
994225675 5:97249554-97249576 CTGGCCAACCAGGGTGAGAAGGG - Intergenic
995756130 5:115506313-115506335 GTGGGCAAGAAGAAGGAGACTGG - Intergenic
998449171 5:142220989-142221011 GTGGGGAGCCAGAGGGAGAGGGG + Intergenic
1000361728 5:160453900-160453922 GAGGGCAACAAAAGTGAGAATGG - Intergenic
1007631235 6:43274788-43274810 GTGGGGAACCAGAGGGATATGGG - Intronic
1011083637 6:83515527-83515549 CTGGACAACTAGAATGAGACAGG - Intronic
1012494565 6:99819947-99819969 GTAGTTAGCCAGAGTGAGACTGG - Intergenic
1017770997 6:157644429-157644451 GTAGGGAACCAGAGAGACACAGG - Intronic
1019292282 7:256629-256651 GCGGGGAGCCAGCGTGAGACGGG - Intronic
1019751733 7:2734980-2735002 GTGGGAAGCCAGCGTGAGGCCGG + Intronic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1023831512 7:44041124-44041146 GTGGGCAGCTGGAGTGGGACTGG - Intergenic
1024014924 7:45305089-45305111 GAAGGCAGCCAGAGTAAGACAGG + Intergenic
1024798688 7:53050582-53050604 GTGAGCAACCAAAGGAAGACAGG - Intergenic
1027805685 7:82818729-82818751 GTGAGCAATCAGAGTCAGAGGGG - Intronic
1028370100 7:90082185-90082207 GTGGGTAACCTGAGTGACAGCGG + Intergenic
1028623219 7:92847059-92847081 GAGGTCACCCAGAGTGAGAGTGG - Intergenic
1029741834 7:102495428-102495450 GTGGGCAGCTGGAGTGGGACTGG - Intronic
1029759825 7:102594597-102594619 GTGGGCAGCTGGAGTGGGACTGG - Intronic
1029777187 7:102690507-102690529 GTGGGCAGCTGGAGTGGGACTGG - Intergenic
1030303685 7:107999629-107999651 GTGGGCATCAAGATTGAGACAGG - Intronic
1030936862 7:115595322-115595344 GAGGGCAGCCAGAGAGAGATTGG + Intergenic
1032700238 7:134372858-134372880 GTGGGCAACCAGGGCTAGCCTGG - Intergenic
1033096823 7:138439487-138439509 GTAGGAAATCAGAGTGAGTCAGG + Intergenic
1034446782 7:151117765-151117787 GTGGGCACGCAGGGTGAGGCGGG + Exonic
1036030058 8:4960400-4960422 GTGGGAAAGAAGAGTGAGATCGG - Intronic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1043958711 8:86390688-86390710 GTGGGAGACGAGAGGGAGACGGG + Intronic
1044436634 8:92171838-92171860 ATGGTCCACCAGAGTGAGAAAGG - Intergenic
1045101659 8:98850717-98850739 GTGGGCAGCAAGAATGAGGCTGG + Intronic
1045153258 8:99434290-99434312 GTGAGCAACTAGAGTGAGTTTGG + Intronic
1045573422 8:103393402-103393424 GTGGGCATACAGAGGGAGTCAGG - Intergenic
1047264244 8:123290996-123291018 CTGGGCAACAAGAGCGAAACTGG - Intergenic
1049129820 8:140828361-140828383 GAGTGTAGCCAGAGTGAGACAGG - Intronic
1053131304 9:35617256-35617278 GGGAGCATCCAGTGTGAGACCGG + Intronic
1054924960 9:70579857-70579879 GAGGGCAAGAAAAGTGAGACAGG - Intronic
1056433882 9:86556390-86556412 CTGGGCAACAAGAGTGAAACTGG + Intergenic
1059613745 9:115926543-115926565 GTTGGCAACCAGAGAGATAAAGG - Intergenic
1059658599 9:116379086-116379108 CTGGGCAACCAGTGTGACAGCGG + Intronic
1059827928 9:118053336-118053358 GTGAACAACCAGAATGAGATTGG - Intergenic
1061061044 9:128250711-128250733 GTGGGCGACCTGAGGGCGACAGG - Exonic
1061955080 9:133957066-133957088 GTGAGGAACCAGAGAGACACTGG - Intronic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1186677191 X:11831132-11831154 GTGGGGAGCCAGATTGGGACAGG + Intergenic
1186826166 X:13341947-13341969 GTGGGCAAGTGGAGTGATACCGG + Intergenic
1187227345 X:17386301-17386323 GAGGACAACCAGAGTGGGAATGG - Intronic
1188429617 X:30091681-30091703 GTGGGCAACCAGGGAGAAATGGG - Intergenic
1189103455 X:38214055-38214077 GTGGGGAACCAGAGATAGGCAGG - Intronic
1190186552 X:48239785-48239807 CTGGGCAACAATAGTGAAACTGG - Intronic
1190334283 X:49253034-49253056 GAGGGCACTCAGAGGGAGACAGG + Intronic
1192418032 X:71002037-71002059 CTGGGCAATAAGAGTGAGATTGG + Intergenic
1192827967 X:74718388-74718410 GTGCCCAACCACAGTGAGAGTGG - Intergenic
1197308774 X:124878337-124878359 GTGGGGATCCAGAGTCAAACTGG + Intronic
1197815762 X:130496272-130496294 GTGGGTAATCAGAGTGAAAGAGG - Intergenic
1198587628 X:138140223-138140245 AGGGCCATCCAGAGTGAGACAGG + Intergenic
1200845830 Y:7831611-7831633 GGGGGAGCCCAGAGTGAGACCGG - Intergenic
1201555326 Y:15260498-15260520 GTGGGCGCACAGTGTGAGACTGG + Intergenic