ID: 1179966605

View in Genome Browser
Species Human (GRCh38)
Location 21:44810466-44810488
Sequence CCGTGGGAGGCACAGGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 384}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179966605_1179966615 17 Left 1179966605 21:44810466-44810488 CCACAACCCTGTGCCTCCCACGG 0: 1
1: 0
2: 0
3: 27
4: 384
Right 1179966615 21:44810506-44810528 GCTTTCTGAGAAGGTGGGTGCGG 0: 1
1: 0
2: 3
3: 48
4: 370
1179966605_1179966616 26 Left 1179966605 21:44810466-44810488 CCACAACCCTGTGCCTCCCACGG 0: 1
1: 0
2: 0
3: 27
4: 384
Right 1179966616 21:44810515-44810537 GAAGGTGGGTGCGGAGCTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 256
1179966605_1179966612 8 Left 1179966605 21:44810466-44810488 CCACAACCCTGTGCCTCCCACGG 0: 1
1: 0
2: 0
3: 27
4: 384
Right 1179966612 21:44810497-44810519 ATGAGATGTGCTTTCTGAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 235
1179966605_1179966613 11 Left 1179966605 21:44810466-44810488 CCACAACCCTGTGCCTCCCACGG 0: 1
1: 0
2: 0
3: 27
4: 384
Right 1179966613 21:44810500-44810522 AGATGTGCTTTCTGAGAAGGTGG 0: 1
1: 0
2: 1
3: 32
4: 265
1179966605_1179966614 12 Left 1179966605 21:44810466-44810488 CCACAACCCTGTGCCTCCCACGG 0: 1
1: 0
2: 0
3: 27
4: 384
Right 1179966614 21:44810501-44810523 GATGTGCTTTCTGAGAAGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179966605 Original CRISPR CCGTGGGAGGCACAGGGTTG TGG (reversed) Intronic
900100941 1:961782-961804 GTGAGGGAGGCACAGGGTCGGGG - Intronic
900515749 1:3081468-3081490 CCGTGTGAGGAGCAGGGCTGAGG + Intronic
900601796 1:3505865-3505887 GGCTGGGAGGCACAAGGTTGGGG + Intronic
900673992 1:3872662-3872684 CCGTGGCAGGGACAGGGCCGTGG - Intronic
900780907 1:4616699-4616721 AGGTGGTTGGCACAGGGTTGAGG - Intergenic
900948455 1:5844305-5844327 CCGTAGGAGGCAGAGGGAGGGGG + Intergenic
901229085 1:7631986-7632008 CACTGGGTGGCACAGGGCTGTGG - Intronic
901296701 1:8166288-8166310 ACGGGGTAGGCACAGGGTGGAGG + Intergenic
902167069 1:14581222-14581244 CGGTGGGAGGAGCAGGTTTGGGG - Intergenic
902241637 1:15094088-15094110 CCCCGGGAGGCAGAGGGTGGTGG - Intronic
903308264 1:22429917-22429939 CCCCGGGAGGCGGAGGGTTGCGG + Intergenic
905828978 1:41049026-41049048 CTGTGGGAGGTAGAGGGTGGAGG + Intronic
906520218 1:46462323-46462345 CTGTGGTGGGGACAGGGTTGAGG + Intergenic
908211337 1:61903407-61903429 CTGTGGGAGGAACAGATTTGGGG + Intronic
908396839 1:63733025-63733047 CCATGGGAAGCTCAGGGTGGAGG + Intergenic
909563291 1:77028077-77028099 GTGTGGGAGGCACAGGGCAGAGG - Intronic
911629314 1:100164816-100164838 ACTTGGGAGGCAGAGGGGTGAGG - Intronic
912916491 1:113820379-113820401 ACCTGGGAGGCAGAGGGATGAGG + Intronic
915262447 1:154686970-154686992 ATGGGGGAGGCACAGGGATGAGG - Intergenic
915723237 1:157999308-157999330 ACGTGGGAGGAAAAGGATTGAGG - Intronic
918529219 1:185499694-185499716 ACGTGGGTCACACAGGGTTGGGG + Intergenic
918608871 1:186463770-186463792 CGGCGGGAGGAGCAGGGTTGGGG - Intergenic
919910983 1:202110649-202110671 CCTTGGGAGGCAGAGGCTAGTGG - Intergenic
921161898 1:212478848-212478870 CCGTGGGATGCTCAGGCTGGGGG - Intergenic
921201406 1:212810118-212810140 CTTTGGGAGGCCAAGGGTTGCGG + Intronic
922209414 1:223476164-223476186 CCATGGGAGGGAGAGGGGTGTGG - Intergenic
922693543 1:227713608-227713630 CCGTGGGTTGCACAGTTTTGTGG - Intergenic
922707037 1:227795380-227795402 CCGTGGGAAGGAGGGGGTTGGGG - Intergenic
922707050 1:227795409-227795431 CCGTGGGAAGGAGAGGGTGGGGG - Intergenic
922707074 1:227795467-227795489 CCGTGGGAAGGAGGGGGTTGGGG - Intergenic
922707120 1:227795586-227795608 CCGTGGGAAGGAGGGGGTTGGGG - Intergenic
922822621 1:228494495-228494517 TCCTGGGAGGCACAGGAGTGGGG - Exonic
922881843 1:228986934-228986956 CCGTAGGGGACACAGGGTAGGGG - Intergenic
924011193 1:239666734-239666756 CTGTGGGAGGCTGAGGTTTGGGG + Intronic
924939424 1:248802499-248802521 CCGTGGAAGGCACAGGGGAAAGG - Intergenic
1062886998 10:1024250-1024272 ACCTGGGAGGGACGGGGTTGAGG + Intronic
1063350662 10:5351846-5351868 CTGTGGGAGGCACAGGCATGAGG + Intergenic
1063636626 10:7788388-7788410 CCGTCGGAGGCGCCGGGTAGCGG + Intronic
1065518009 10:26544148-26544170 TTGTGGGAGGGACAGGGTAGTGG - Intronic
1065711459 10:28522158-28522180 CCCCGGGAGGCCCAGGCTTGCGG + Intergenic
1066387709 10:34955071-34955093 CCTGGGGAGGCCCAGGGGTGAGG - Intergenic
1067178605 10:43968395-43968417 CCGTGAAAGCCACAGGCTTGTGG + Intergenic
1067849126 10:49743929-49743951 CCCTTCGAGGCACAGTGTTGGGG + Intronic
1068259256 10:54556865-54556887 CCCTGGGAGTGGCAGGGTTGGGG + Intronic
1069850513 10:71401260-71401282 GCGAGGGAGGCACAGGCTGGAGG - Intronic
1069882682 10:71603471-71603493 CTCTGGGAGGCACAGGCTGGGGG + Intronic
1069968029 10:72137939-72137961 GCCTGGGAGGCAGAGGGTTGCGG - Intronic
1070170183 10:73926969-73926991 ACTTGGGAGGCTCAGGGGTGAGG + Intergenic
1073081376 10:100863109-100863131 CCATGGGAGTCAGAGTGTTGAGG + Intergenic
1073509649 10:104035080-104035102 CCGTGGCAGGGACAGAGGTGGGG - Intronic
1076491369 10:130863875-130863897 GGGTGGGAGGCCCAGGGTGGTGG + Intergenic
1077047343 11:552356-552378 CCGTGGGGGGATCAGGGCTGGGG + Intronic
1077047366 11:552439-552461 CCGTGGGGGGATCAGGGCTGGGG + Intronic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077330294 11:1981222-1981244 CCGGTGGGGGCACAGGGATGAGG - Intronic
1077578759 11:3403716-3403738 TCGTGGGAAGCACAGGGTAAAGG - Intergenic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1079045218 11:17095839-17095861 ACCTGGGAGGCACAGGTTTCAGG + Intronic
1081861134 11:46333881-46333903 CTGTGCCAGGCACAGGCTTGTGG + Intronic
1082799807 11:57406272-57406294 CAGTGGGAGGCAGGGGGATGGGG - Intronic
1083857787 11:65401566-65401588 GCATGGGAGGCGCAGGGGTGGGG - Intronic
1084235787 11:67787232-67787254 TCGTGGGAAGCACAGGGTAAAGG - Intergenic
1084446898 11:69209033-69209055 CTGCGTGAGGCACAGGGTTCGGG + Intergenic
1084451657 11:69242635-69242657 CAGAGGGAGGCAGAGGGGTGGGG + Intergenic
1084650138 11:70484798-70484820 GCTTGGGAGGCACAGGGTCATGG - Intronic
1084679247 11:70656490-70656512 CCGTGGGAGGGGCAGGGCGGCGG - Intronic
1084950961 11:72665257-72665279 GGGTGGGAGGCCCATGGTTGTGG - Intronic
1085832707 11:79918408-79918430 CCTGGGGAGGCACAGGCTTTTGG + Intergenic
1085912866 11:80849248-80849270 CCGTGGGAGGCAGAGGCAGGAGG + Intergenic
1090402221 11:126456286-126456308 ACGTGAGAGGCACGGGGGTGGGG + Intronic
1090472967 11:126996461-126996483 CCTTGGGAGGGGCAGGGTTGGGG - Intronic
1090616258 11:128518119-128518141 CTGTTGGAGGCACAGGGAGGGGG - Intronic
1090989310 11:131801886-131801908 GTGTGGGTGGCACAGGGCTGGGG - Intronic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1202813273 11_KI270721v1_random:36401-36423 CCGGTGGGGGCACAGGGATGAGG - Intergenic
1091867950 12:3858844-3858866 CCCTGGGAGGCCCAGGTGTGTGG + Intronic
1092124926 12:6068333-6068355 CTTTGGGAGGTAGAGGGTTGTGG - Intronic
1095880978 12:47135775-47135797 ACGCTGGAGGCACAGGGTTGTGG + Intronic
1096650209 12:53058846-53058868 GGGTGGGAGGTACAGGGTTGTGG + Intronic
1099201168 12:79678890-79678912 GGGTGGGAGGCACAGGATGGTGG + Intronic
1099639112 12:85261865-85261887 ACCTGGGAGGCGGAGGGTTGCGG - Intronic
1100540720 12:95554971-95554993 ACTTGGGAGGCACAGGTGTGAGG - Intergenic
1105410510 13:20167868-20167890 AGGAAGGAGGCACAGGGTTGGGG - Intergenic
1107064053 13:36193417-36193439 CTGCGGTAGGCACAGGGTTTTGG - Intronic
1110727643 13:78843753-78843775 CCGTGGGTGGCAGGGGGTGGCGG - Intergenic
1111979885 13:95004277-95004299 CCCTGGGACCCACAGGGTAGAGG + Intergenic
1113779240 13:112966665-112966687 GAGTGGATGGCACAGGGTTGAGG + Intronic
1113840895 13:113360696-113360718 GGGTGGGAGCCACAGGGCTGTGG - Intronic
1117538062 14:56720503-56720525 CCCCAGGAGGCACATGGTTGTGG + Intronic
1118049874 14:62014959-62014981 ACGAGGAAGGCACAAGGTTGGGG - Intronic
1118600009 14:67465363-67465385 CCCTGGATGGCACAGGGCTGGGG + Intronic
1119348012 14:73942330-73942352 CTGTGGGAGGGTCAGGGCTGCGG - Intronic
1119507336 14:75184212-75184234 CCTTGGGAGGCAGAGGCTGGAGG - Intergenic
1119659126 14:76438005-76438027 CTGGGGGATGCTCAGGGTTGGGG + Intronic
1121323191 14:93004779-93004801 GTGCGGGGGGCACAGGGTTGGGG + Intronic
1122988336 14:105223674-105223696 CCGTGGGAGCCACAGATCTGTGG + Intronic
1124341012 15:28889107-28889129 CGGTGGGCGGCAGGGGGTTGGGG - Intronic
1124350543 15:28952421-28952443 CCGTGGGAGGCAGAGGCAAGAGG + Intronic
1124396470 15:29306189-29306211 CTGTGGGAGGCGCAGGGCTCAGG + Intronic
1124616466 15:31245766-31245788 CGGTGAGAGGCACATGGGTGGGG + Intergenic
1125385508 15:39132361-39132383 CCGTGGGTGTCACACAGTTGGGG - Intergenic
1128080718 15:64855365-64855387 CTGGGGGAGGCCCAGGGCTGAGG + Intronic
1128467421 15:67924604-67924626 GAGTAGGAGGCCCAGGGTTGAGG - Intergenic
1129276721 15:74450329-74450351 GCCTGGGAGGCTCAGGGTTCTGG + Intronic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129604518 15:77018388-77018410 CTGGGGGAGGCCCAGGTTTGAGG - Intronic
1129683092 15:77669321-77669343 CTGTGGGAGGCAAAGGGATGGGG - Intronic
1129851458 15:78796294-78796316 CCCAGGCAAGCACAGGGTTGTGG + Intronic
1129937667 15:79464114-79464136 CTGTGGGAGGTACAGTGTGGTGG + Intronic
1130460048 15:84153949-84153971 GCGTGGGAGGTTCGGGGTTGGGG - Intergenic
1131399216 15:92111101-92111123 CTGTGGGAAGCACAGTGGTGGGG - Intronic
1132161277 15:99545141-99545163 CCCTGGGAGGTCGAGGGTTGAGG + Intergenic
1132477019 16:144740-144762 GCCTGGGAGGTAGAGGGTTGCGG + Intergenic
1132521665 16:393220-393242 CTGTGGGAGGCAGAGGTTGGAGG - Intergenic
1132835382 16:1950368-1950390 CTGTGGGAAGCTCAGGGTCGGGG + Intronic
1133358224 16:5152803-5152825 CCATGGGACACACAGGCTTGTGG + Intergenic
1135425062 16:22328334-22328356 AGGTGAGAGGCACAGGTTTGTGG + Intronic
1136418675 16:30118575-30118597 CAGTGGGAGGCACTTGGTTAAGG + Intronic
1137505988 16:49054057-49054079 CCCTGGGAGACACTGGGGTGGGG - Intergenic
1139478927 16:67217614-67217636 CTGAGGAAGGCACAGGGCTGGGG - Intronic
1139567979 16:67791600-67791622 CCCTGGGAGGTCTAGGGTTGGGG - Intronic
1139670997 16:68492521-68492543 CAGTAGCAGCCACAGGGTTGGGG + Intergenic
1139782578 16:69364180-69364202 CCGTGGGAGATACAAGATTGGGG + Intronic
1140410996 16:74740216-74740238 CCGTGGGTGGGGCAGGGTGGTGG + Intronic
1140761115 16:78109665-78109687 GGGTGGGAGGGACAGGCTTGGGG + Intronic
1141497695 16:84421227-84421249 CCGCGGGAGCCACAGGGAGGTGG + Intronic
1142157112 16:88537636-88537658 ACAGGGGAGGCACAGGGTGGAGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142990869 17:3730037-3730059 CTGTGGGAGGGGCAGGGTTGGGG - Intronic
1143001281 17:3796755-3796777 CTGGGGGAGACAGAGGGTTGAGG - Intronic
1143128374 17:4659666-4659688 CCTTGGGAGGCAGAGGCCTGAGG - Intergenic
1143645650 17:8228418-8228440 CCCTGGGAGGAAGAGGGATGAGG - Intronic
1143713974 17:8753899-8753921 GTGTGGGAGGAACAGGGATGGGG - Intronic
1144725167 17:17498223-17498245 CTGTGGGAGGCACAGGAAGGCGG - Intergenic
1144802087 17:17936328-17936350 TAGTGTGAGGAACAGGGTTGGGG - Intronic
1144959820 17:19038769-19038791 GCGTAGGGGGCCCAGGGTTGGGG + Intronic
1144975340 17:19135755-19135777 GCGTAGGGGGCCCAGGGTTGGGG - Intronic
1146049258 17:29536047-29536069 CTTTGGGAGGCCGAGGGTTGGGG + Intronic
1146728025 17:35171301-35171323 GTCTGGAAGGCACAGGGTTGGGG - Exonic
1146900354 17:36581634-36581656 CTTTGGGAGGCCCAGGGTGGAGG + Intronic
1147165930 17:38593299-38593321 CCTCAGGAGGAACAGGGTTGGGG + Intronic
1147265435 17:39231717-39231739 CTGTTGGAAGCACAGGGGTGGGG - Intergenic
1147414342 17:40277801-40277823 ACCTGGGAGGCAGAGGTTTGGGG - Intronic
1148586527 17:48785093-48785115 CCGTGGGAGCCTCCTGGTTGAGG + Exonic
1149234996 17:54578847-54578869 TTGTGGGAGGCACAGTGCTGTGG + Intergenic
1151224016 17:72635147-72635169 CCTTCTGAGGCTCAGGGTTGGGG - Intergenic
1151491250 17:74433241-74433263 CAGTTGAAGGCACAGGGGTGGGG - Intronic
1152076168 17:78161262-78161284 CGGTGGGGGGCACAGGGCTGAGG + Intronic
1152315881 17:79579938-79579960 GTGGGGGAGTCACAGGGTTGGGG + Intergenic
1152567465 17:81106669-81106691 TCCAGGGAGCCACAGGGTTGTGG + Intronic
1152622402 17:81372024-81372046 CCTGGGGAGGCACAGGGTGAGGG + Intergenic
1152723642 17:81934832-81934854 CCCTGGGAGGGCCAGGGTGGAGG - Intronic
1152818699 17:82424514-82424536 CCGTGGCAGGTACAGGGGCGCGG + Intronic
1152898801 17:82928427-82928449 CTGTCGGGGGCACGGGGTTGTGG + Intronic
1152903583 17:82958551-82958573 CAGGGGGTGCCACAGGGTTGGGG - Intronic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1153482145 18:5557459-5557481 GCCTGGGAGGCGGAGGGTTGGGG - Intronic
1154448866 18:14458971-14458993 CGGTGGCTTGCACAGGGTTGGGG - Intergenic
1155960511 18:31991023-31991045 CTGTGACATGCACAGGGTTGAGG - Intergenic
1158633664 18:59138032-59138054 CTGTGGGTGGAACAGGTTTGTGG - Intergenic
1160499892 18:79396376-79396398 CCGTGGGGGGCGCAGGGGTCCGG - Intronic
1160704625 19:524235-524257 CAGTGGGCGGCACAGGGTCAGGG - Intergenic
1160727754 19:625075-625097 CCCTGGGAGGGACATGGTGGGGG + Intronic
1161088345 19:2345230-2345252 CTGGGGGAGGCACAGGGCGGAGG - Intronic
1161348252 19:3778474-3778496 CCCAGGGAGGCACTGGGTTCCGG - Intronic
1161445750 19:4318309-4318331 ACGTGGGAGTCACAGAGATGGGG - Intronic
1161476145 19:4486717-4486739 CCGTGGGTGGCTCATGCTTGTGG - Intronic
1161604009 19:5204496-5204518 CCGTGTGATGCTCAGGGCTGCGG + Intronic
1162514428 19:11139355-11139377 CTGTGGGAGGCCCAGGGAGGAGG - Intronic
1162732635 19:12728171-12728193 GGGTGGAAGGCACAGGGCTGTGG - Intergenic
1162969701 19:14173066-14173088 CCTTGGGAGGCAGAGGCTGGAGG - Intronic
1163476016 19:17526692-17526714 TGGTGGGAGGGACAGTGTTGGGG + Intronic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1163904206 19:20137521-20137543 CCTTGGGAGGCCCAGGCTGGCGG - Intergenic
1164575081 19:29401190-29401212 GCGTGGGAGGCACAGACCTGTGG - Intergenic
1164606823 19:29605612-29605634 CCGTGGGAGGCGCAGGCGGGAGG - Exonic
1165034242 19:33021686-33021708 CCGTGGGGTGCACAGGGGTCCGG - Intronic
1165232406 19:34395283-34395305 CCTTGGGAGGCAGAGGCTGGGGG + Intronic
1165256252 19:34578651-34578673 CCATGGGAGTCACAGGTGTGTGG - Intergenic
1165526034 19:36355432-36355454 CCTTGGGAGGCAGAGGTATGAGG + Intronic
1165758861 19:38309164-38309186 CTGTGGGGGGCTCAGGGGTGGGG - Intronic
1165888981 19:39099246-39099268 CCGTGGAGGGGACAGGGCTGGGG + Intronic
1166108222 19:40607988-40608010 TGGTGGTAGGAACAGGGTTGAGG - Intronic
1166183360 19:41123905-41123927 CCCTGGCAGGCACATGGCTGGGG - Intronic
1166887663 19:45971845-45971867 CCGTGGGGGGCTCAGGGAAGAGG - Intronic
1167094949 19:47370247-47370269 CCTTGGGAGGCACAGGCAGGTGG + Intronic
1167269155 19:48498300-48498322 CACTGGGAGGCTCAGGCTTGGGG + Exonic
1167423413 19:49416973-49416995 GCGTTGGAGGCACCGGGTTCTGG - Intronic
1167744250 19:51341384-51341406 AGGTGGGGGGCCCAGGGTTGGGG + Exonic
1167812371 19:51845621-51845643 CTGGGGGAGGGAGAGGGTTGTGG - Intergenic
1168605745 19:57758819-57758841 CTGTGGGACTCACAGGCTTGTGG - Intergenic
1168624266 19:57904459-57904481 CCGGTGGAGGCAAAGTGTTGGGG - Intronic
925875617 2:8308962-8308984 CAGTGGGACTCACAGGGTGGCGG + Intergenic
926764737 2:16314366-16314388 CTGTGGGAGGAACATGTTTGAGG + Intergenic
926991115 2:18681440-18681462 CAGTGCAAGGCACAGAGTTGGGG + Intergenic
927254033 2:21024372-21024394 CTGTGGGAGGCCCAGGCTGGAGG + Intronic
927828892 2:26330932-26330954 CAGTGGGAGAGACAGGGTGGAGG + Intronic
927957566 2:27218189-27218211 CCTTGGGAGGCACAGAGTGTTGG + Intronic
932018672 2:68060033-68060055 CTGTGGGAGGGGCAGGTTTGTGG - Intronic
932254177 2:70269578-70269600 CATTGGGAGGCACAGGCTGGAGG - Intronic
932592972 2:73078239-73078261 CCATGAGAGGCGCAGGGTTTAGG - Intronic
934059383 2:88280079-88280101 GCCCGGGAGGCATAGGGTTGCGG - Intergenic
935144928 2:100389114-100389136 TGCTGGGAGGCACTGGGTTGGGG + Intergenic
935814547 2:106835013-106835035 CAGTGGGAGGCACAGGAAAGTGG + Intronic
936344418 2:111664365-111664387 CCTGGGGAGGCACAGGCATGAGG + Intergenic
936351954 2:111719706-111719728 CCGTGGGAGACACAAAGCTGAGG - Intergenic
937052246 2:118901992-118902014 CCCTGGGAGGGGCAGGGATGAGG - Intergenic
937957091 2:127427575-127427597 CTGTGGGAGGCACAGCCCTGAGG - Intronic
938824529 2:134991878-134991900 CCCTGTGAGGAACTGGGTTGTGG - Intronic
938869791 2:135463210-135463232 CAGTGGGAGGCACAGGGGTTGGG + Intronic
942413281 2:175733729-175733751 CCGTGGGAAGCAGAGGGATCTGG - Intergenic
944412763 2:199458979-199459001 CTGTGGGTGGCACAGGAATGGGG + Intronic
946024589 2:216664315-216664337 CCGGGGGAGGAAGGGGGTTGTGG + Exonic
946200307 2:218067696-218067718 CAGTGGCAGGGACAGGGATGGGG - Intronic
947749279 2:232524285-232524307 CCTGGGGAGGCACAGGGTTAGGG - Exonic
948548002 2:238746211-238746233 CAGTGGGGGGCACAGGCTGGAGG - Intergenic
948760386 2:240186551-240186573 CTGTGGGAGGAACAGCCTTGAGG + Intergenic
948795810 2:240401591-240401613 CTGTGAGATGCACAGGGCTGTGG - Intergenic
948932582 2:241141641-241141663 CCGTGGGAGGTCCAGGCTGGAGG - Intronic
948971553 2:241431896-241431918 ACCCGGGAGGCAGAGGGTTGCGG - Intronic
1172005395 20:31815943-31815965 CCCTTGGAGGCACAGGGGTGGGG - Intergenic
1172564603 20:35919091-35919113 ACCTGGGAGGCAGAGGGTGGTGG - Intronic
1172634687 20:36402005-36402027 CAGTGGCAGGGCCAGGGTTGGGG + Intronic
1173668641 20:44781802-44781824 CCTTGGAAGGAACTGGGTTGTGG + Intronic
1174213416 20:48898054-48898076 CTGTGGGAGGAACAGATTTGTGG - Intergenic
1174411516 20:50339647-50339669 CTTTGGGAGCCACAGGGATGTGG + Intergenic
1175873307 20:62218415-62218437 CCATGGGAGGCACCTGGGTGGGG - Intronic
1176023234 20:62973134-62973156 CTGGGCGAGGCACAGGGCTGTGG + Intergenic
1176106591 20:63392388-63392410 CCTGAGAAGGCACAGGGTTGCGG + Intergenic
1176126428 20:63477401-63477423 CACTGGGAGGCACGGGGTGGTGG - Intergenic
1176180177 20:63746230-63746252 TGGTGGGGGGCACAGGGCTGAGG + Exonic
1176276254 20:64271538-64271560 CTGTGGGAGGCTCAGGATTCTGG + Intronic
1176286631 21:5022281-5022303 CCCTGGGAAGCGCAGGGGTGGGG - Intergenic
1176376582 21:6089685-6089707 GCATGGCAGGCACAGGGTTGAGG - Intergenic
1178358079 21:31924801-31924823 CCGTGGGTGGCACTGGGCTGTGG + Intronic
1179746893 21:43448559-43448581 GCATGGCAGGCACAGGGTTGAGG + Intergenic
1179824611 21:43957181-43957203 CCCTGAGAGGCAGAGGGTGGGGG + Intronic
1179870550 21:44241194-44241216 CCCTGGGAAGCGCAGGGGTGGGG + Intergenic
1179896369 21:44365829-44365851 CCCTGGGAGGAGCAGGGCTGTGG - Intronic
1179904437 21:44415028-44415050 CCGTCTGAGGCACACGGTGGGGG - Intronic
1179966605 21:44810466-44810488 CCGTGGGAGGCACAGGGTTGTGG - Intronic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180835717 22:18928563-18928585 GCTGGGGAGGCAGAGGGTTGGGG - Intronic
1181112032 22:20607845-20607867 CGGTGGGTGGCACAGGGCTATGG + Intergenic
1181568091 22:23751684-23751706 CCCTGGGATGCAGAGAGTTGGGG - Intergenic
1183072099 22:35403344-35403366 CCCTGGGAAGCTCAGGGATGGGG - Intronic
1183146376 22:35996248-35996270 CCGTGGGAGACATATGGGTGAGG - Intronic
1183491747 22:38120601-38120623 CCCAGGGAGGCAGAGGGCTGGGG - Intronic
1183614773 22:38937266-38937288 CCGTGGGAAGCCCTGGGCTGGGG - Intergenic
1184066323 22:42123815-42123837 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184068791 22:42135967-42135989 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184101847 22:42344892-42344914 CCGTGGCAGGCACAGGGCACCGG + Intergenic
1184121812 22:42455668-42455690 CCTTGGGAGGCAGAGGTTGGTGG + Intergenic
1184230982 22:43158319-43158341 CCCAGGGGGGCACAGGGCTGGGG - Intronic
1184235178 22:43179482-43179504 CCGTGGGAGGCATAGAGTTTTGG - Intronic
1184333793 22:43841549-43841571 GCCTGGGGGGCACAGGGCTGAGG - Intronic
1184467863 22:44679459-44679481 CCTTGGGAGGCCAAGGCTTGTGG + Exonic
1184667911 22:45998178-45998200 GGGTAGGAGGCACAGGGTGGTGG - Intergenic
1185341284 22:50292403-50292425 CCGTCAGAGACACAGGGATGTGG - Intronic
1185370429 22:50458458-50458480 CTGTGGGAAGCACAGGCATGGGG + Intronic
1203285806 22_KI270734v1_random:153862-153884 GCTGGGGAGGCAGAGGGTTGGGG - Intergenic
951563397 3:23989514-23989536 CAGGCAGAGGCACAGGGTTGGGG - Intergenic
953879569 3:46684622-46684644 ACGTGGGAGGCCCAGGCCTGAGG + Intronic
954215596 3:49122689-49122711 ACGTGGGAGGCTCACGGTTGAGG + Exonic
954423684 3:50432229-50432251 CCTTGGGAATCACAGGGCTGGGG - Intronic
955523207 3:59795140-59795162 CCGTGGGAGGCTGAGGCATGCGG + Intronic
956781395 3:72606094-72606116 TCGGGGGAGGCAGGGGGTTGGGG - Intergenic
957051757 3:75417035-75417057 TCGTGGGAAGCACAGGGTAAAGG - Intergenic
957593621 3:82232252-82232274 ACTTGGGAGGCTGAGGGTTGAGG - Intergenic
957864030 3:85999253-85999275 CTTTGGGAGGCCGAGGGTTGGGG + Intronic
957952204 3:87141527-87141549 CCCAGGGAGCCACAGGGTTTGGG - Intergenic
959059223 3:101601032-101601054 CTGTGGGAGGCCAAGGGTGGGGG - Intergenic
959085608 3:101849020-101849042 CCGGGGCAGGCAGAGGGGTGCGG + Intronic
961302712 3:125932564-125932586 TCGTGGGAAGCACAGGGTAAAGG + Intronic
961625329 3:128258329-128258351 CCGTGGGAAGGACAGGGCTCTGG + Intronic
961885353 3:130093224-130093246 TCGTGGGAAGCACAGGGTAAAGG - Intronic
962894844 3:139704852-139704874 CAGTGGCAGGCATAGAGTTGTGG + Intergenic
963025021 3:140911022-140911044 CTTTGGGAGTCACAGGGTCGGGG - Intergenic
964118654 3:153161174-153161196 AAGTGGGAGGCAGAGGGTGGGGG + Intergenic
966120245 3:176512298-176512320 CCATGGGCTGGACAGGGTTGAGG + Intergenic
966158600 3:176945197-176945219 CACTGGGAGGCAGAGGGTAGGGG + Intergenic
967746808 3:193065520-193065542 AAGTGAGAGGCACAGGGTGGGGG - Intergenic
967814725 3:193788990-193789012 TTGTGTAAGGCACAGGGTTGGGG + Intergenic
967814759 3:193789196-193789218 CAGTGGGTGGCAGAGGGTGGGGG + Intergenic
967841521 3:194008650-194008672 CTGTGGGAGGCACAGGCAGGCGG + Intergenic
967844947 3:194035822-194035844 CTGTGGGAGGAACAGGGATGTGG + Intergenic
968008831 3:195260125-195260147 CCGCGGGAGCCTCAGGCTTGGGG + Intronic
968379809 4:82459-82481 ACCTGGGAGGCAGAGGGTTGTGG - Intronic
968419711 4:473744-473766 CCGGGGAAGGTGCAGGGTTGCGG + Intronic
968631483 4:1654361-1654383 CCGTGGTTGGCACAGAGTTAAGG - Intronic
968968411 4:3781105-3781127 CCGTGGGCGGCTCAGGGCTCTGG - Intergenic
968994551 4:3937410-3937432 TCGTGGGAAGCACAGGGTAAAGG - Intergenic
969006644 4:4025525-4025547 CCGTGGGACACTCAGGCTTGTGG + Intergenic
969407052 4:7000495-7000517 TCGTGGGGAGCACAGGCTTGAGG - Intronic
969759440 4:9171399-9171421 TCGTGGGAAGCACAGGGTAAAGG + Intronic
971294095 4:25374027-25374049 CTTTGGGAGGCCAAGGGTTGGGG + Intergenic
974443654 4:61951373-61951395 AAGTAGGAGGCTCAGGGTTGGGG + Intronic
975101786 4:70522023-70522045 TCCTGGAAGGCACAGGGGTGTGG - Intronic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
976980762 4:91224331-91224353 CTGTGGGAGGCAAAGAGATGAGG + Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
982713220 4:158779825-158779847 CTTTGGGAGGCTCAGGGTGGGGG - Intronic
982998377 4:162380857-162380879 ACTCGGGAGGCAGAGGGTTGTGG - Intergenic
985602016 5:840390-840412 GCGTGGGGGGCTCAGGGTTAGGG + Intronic
985729201 5:1537729-1537751 CCGAGTGAGCCTCAGGGTTGGGG + Intergenic
986015074 5:3750720-3750742 CCCTGGGAGGGACAGGGAGGAGG - Intergenic
986246135 5:6008607-6008629 CCGTGGGAGAGACAGAGTTCAGG - Intergenic
986276783 5:6282033-6282055 ACTTGGGAGGGACAGGGATGAGG - Intergenic
988168536 5:27625728-27625750 CTTTGGGAGGCCGAGGGTTGAGG - Intergenic
989270356 5:39526011-39526033 CAGTGGGAGGCACTGGCGTGGGG - Intergenic
990182255 5:53174209-53174231 CCGTGGGAGGCCAAGGTGTGAGG + Intergenic
990539781 5:56760797-56760819 CCTGGGGAGGCAAAGGGCTGGGG - Intergenic
990682921 5:58265716-58265738 CTGTGGGAGGAGCAGGTTTGGGG + Intergenic
991408161 5:66321694-66321716 GGGTTGGAGGCACAGGGATGTGG + Intergenic
996355494 5:122591883-122591905 CCATGGGAGGCACGGGGAAGAGG - Intergenic
996517737 5:124391834-124391856 CTTTGGGAGGCCGAGGGTTGGGG + Intergenic
996574109 5:124963288-124963310 CCCTGGGAGCGACAGGGTTTGGG - Intergenic
996598947 5:125238857-125238879 CTGTGTGAGGCAGAGGCTTGAGG + Intergenic
997304280 5:132826523-132826545 GCCTGGGTGGAACAGGGTTGGGG - Exonic
997555279 5:134792098-134792120 ACCTGGGAGGCACAGGGTGTAGG + Intronic
999269880 5:150290593-150290615 CCGTTGGGGGCATGGGGTTGGGG - Intergenic
1000088828 5:157912174-157912196 ACCTGGGAGGCAGAGGTTTGTGG + Intergenic
1001382460 5:171313517-171313539 CCGAGGGAGGCAGTGGGATGAGG - Intergenic
1002298777 5:178246162-178246184 CCCAGTGAGGTACAGGGTTGGGG + Intronic
1003906086 6:10700979-10701001 CTGTGGGAGGGGAAGGGTTGCGG - Intronic
1004232749 6:13847811-13847833 CTTTGGAAGGCACAGGGCTGGGG - Intergenic
1005667053 6:28068358-28068380 CCCTGGGAGGCACAAGGGTGAGG - Intergenic
1005905482 6:30259408-30259430 ACTGGGGAGTCACAGGGTTGGGG + Intergenic
1006510154 6:34517074-34517096 CCGAGGGAGGAACGGCGTTGGGG - Intronic
1006860424 6:37168960-37168982 CCAAGGGAGGCAGAGGGTGGGGG + Intergenic
1007101565 6:39251139-39251161 CTGTGGGTGGCATAGGGTAGAGG + Intergenic
1007315534 6:40985688-40985710 CAGTGGGAGGCCCAGGGGAGTGG + Intergenic
1007570680 6:42888399-42888421 CTTTGGGAGGCCCAGGCTTGTGG - Exonic
1008191876 6:48468791-48468813 CTGTGGGACACAAAGGGTTGGGG - Intergenic
1008579871 6:52897343-52897365 CAGTGAGAGATACAGGGTTGGGG + Intronic
1009814094 6:68708382-68708404 CAGTGGGAGGCACAGGGTCCAGG - Intronic
1011683658 6:89806471-89806493 CTTTGGGAGGCAGAGGGTGGTGG + Intronic
1011686363 6:89827350-89827372 CCTTGGGAGGCCCAGGCATGAGG + Intergenic
1013302541 6:108818087-108818109 ACCTGGGAGGCACAGCTTTGGGG - Intergenic
1014829933 6:126090965-126090987 CTTTGGGAGGCAAAGGCTTGCGG + Intergenic
1015842169 6:137488143-137488165 CCCTGGGACGCCCAGGGTAGTGG - Intergenic
1018766059 6:166933592-166933614 CCTTGGGAGGCTCAGGCTGGAGG - Intronic
1019295698 7:272871-272893 CTGAGGGAGGCACAGGGCAGAGG - Intergenic
1019594304 7:1851282-1851304 CCTCGGCCGGCACAGGGTTGGGG + Intronic
1019691289 7:2414794-2414816 CTGTGTGAGGCGTAGGGTTGAGG + Intronic
1020122649 7:5513708-5513730 AGGTGGGAGGCACGGGGTTGCGG - Exonic
1020318824 7:6925774-6925796 TCGTGGGAAGCACAGGGTAAAGG - Intergenic
1020999637 7:15312560-15312582 CAGGGGGAGGGACAGGGCTGTGG + Intronic
1021747592 7:23758026-23758048 TCGTAGGGAGCACAGGGTTGGGG + Intronic
1021836909 7:24686071-24686093 CTGTGGGAGATACAGAGTTGAGG - Intronic
1022529277 7:31057125-31057147 CAGAGGGAGGCACAAGCTTGTGG - Intronic
1023382475 7:39623168-39623190 CCCTGGGCGTCTCAGGGTTGAGG - Intergenic
1023844662 7:44113919-44113941 GCGTGGGAGGCACAGTGTGGGGG - Exonic
1023946456 7:44806793-44806815 ACCTGGGAGGCGGAGGGTTGCGG - Intronic
1024312963 7:47986561-47986583 CTTTGGGAGGCCAAGGGTTGGGG - Intergenic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1024963330 7:55001399-55001421 GGCTGGGAGGTACAGGGTTGGGG - Intergenic
1027606390 7:80304773-80304795 CCGTGGGAGGCCCAGGTGGGTGG - Intergenic
1030698670 7:112614940-112614962 CCGTGGGAGGCAAAGGTGGGTGG - Intergenic
1032088976 7:128901381-128901403 CTGTGGGAGGCAGAGGGGGGCGG + Intronic
1032376329 7:131422440-131422462 CTGTGGGAGGCTGAGGCTTGAGG + Intronic
1033733802 7:144202878-144202900 CCGTGGGAGGCTGAGGTGTGTGG - Intergenic
1033749248 7:144348095-144348117 CCGTGGGAGGCTGAGGTGTGTGG + Intergenic
1034878308 7:154744449-154744471 CCGTGGGGGGCCCAGGGAGGAGG - Intronic
1035101603 7:156402187-156402209 CTGTGGGGGCCACAGGGTTCTGG + Intergenic
1035958997 8:4116235-4116257 CTGTGGGAGGCTGAGGCTTGTGG - Intronic
1036381588 8:8239409-8239431 TCGTGGGAAGCACAGGGTGAAGG + Intergenic
1037093191 8:14948070-14948092 CCATAGGAGGTACAGGGTTAAGG + Intronic
1038353186 8:26800013-26800035 CTGTGGGAGGCTGAGGATTGTGG + Intronic
1038454851 8:27666622-27666644 CCGTGGGAGGCACATTGGCGTGG - Intronic
1039074144 8:33673930-33673952 CCCTGGGAGGCAGAGGTTTCAGG - Intergenic
1042856054 8:73268745-73268767 GCGTGGGAGGGAGAGGGTAGTGG + Intergenic
1046619773 8:116516507-116516529 TCTTGGGAGCAACAGGGTTGGGG + Intergenic
1047755862 8:127917924-127917946 CCTTGTGGGGGACAGGGTTGAGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1049190493 8:141284877-141284899 CCGTGGCAGGGACAGGGGCGGGG - Intronic
1049209951 8:141381374-141381396 CAGTGGGAGGCACAGGCTATGGG - Intergenic
1049413500 8:142484441-142484463 CCATGGGAAGCCCAGGATTGGGG - Intronic
1049454998 8:142682280-142682302 CCATGGGAGGGTCAGGGTGGGGG - Exonic
1049551547 8:143262119-143262141 GCGTGGGAGGTGCAGGGGTGCGG - Intronic
1049993189 9:1009486-1009508 CAGTGAGAGGCACAGGAGTGAGG - Intergenic
1050353336 9:4760941-4760963 CAGAGGGAGGGACAGGGTTGGGG - Intergenic
1050932856 9:11351582-11351604 CTGTGGGAGGCACAGGCAAGAGG - Intergenic
1052850595 9:33376161-33376183 CTGTGGGAGGAGCAGGCTTGGGG + Intergenic
1052850935 9:33378103-33378125 CTGGGGTAGGCACTGGGTTGAGG + Intergenic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1053489285 9:38487487-38487509 TCGTGGGAGCCACAGGGCAGGGG - Intergenic
1057199340 9:93132004-93132026 CCGTGGCAGGCAGAAGGATGAGG + Intronic
1057669630 9:97076801-97076823 TCGTGGGAGCCACAGGGCAGGGG - Intergenic
1058133367 9:101278617-101278639 CTGTGGTGGGCCCAGGGTTGGGG - Intronic
1058729481 9:107836199-107836221 TAGTGGGAGGCAGAGGGGTGAGG - Intergenic
1059206278 9:112469283-112469305 CTGTGTGGGGCACAGGGGTGGGG + Intronic
1059227357 9:112684442-112684464 ACTTGGGAGGCTAAGGGTTGAGG + Exonic
1061038012 9:128124158-128124180 ACCCGGGAGGCAGAGGGTTGCGG - Intronic
1061060592 9:128248420-128248442 TCCTGAGAGGCACAGGGATGCGG + Intronic
1061240424 9:129367901-129367923 CTTTGGGAGGCTGAGGGTTGTGG + Intergenic
1061371984 9:130202389-130202411 CCCAGGGAGGCACAGGGCAGTGG - Intronic
1061664886 9:132154834-132154856 CAGTGGGAGGCAGAGGGCTGAGG + Intergenic
1061878098 9:133554830-133554852 TCTGGGCAGGCACAGGGTTGAGG + Intronic
1062286514 9:135775354-135775376 CAGGAGGTGGCACAGGGTTGGGG - Exonic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1062684808 9:137806312-137806334 GCGTGGCAGGGACAGGGATGGGG - Intronic
1188129135 X:26408805-26408827 ACCTGGGAGGCAGAGGGTTGTGG + Intergenic
1189011094 X:37046322-37046344 CTGTGTGAGGCCCAGGGTTCAGG + Intergenic
1189035307 X:37489223-37489245 CTGTGTGAGGCCCAGGGTTAAGG - Intronic
1189305722 X:39985234-39985256 GCGTGCGAGGCACAGAGTGGGGG - Intergenic
1194384412 X:93236007-93236029 CCGCGGGGGGCACAGGGTGGAGG - Intergenic
1197746156 X:129932964-129932986 GCGTTGGTGGCACAGGTTTGGGG - Intergenic
1200120952 X:153790293-153790315 CTGTGGGAGGCAGAGGGTGAAGG + Intronic
1201899086 Y:19028104-19028126 ACTTGGGAGGCTAAGGGTTGAGG + Intergenic
1202379202 Y:24261224-24261246 TCGTGGGAGGTTCGGGGTTGGGG + Intergenic
1202491580 Y:25408897-25408919 TCGTGGGAGGTTCGGGGTTGGGG - Intergenic