ID: 1179967600

View in Genome Browser
Species Human (GRCh38)
Location 21:44816499-44816521
Sequence CCTCATCTGTAAAGGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 826
Summary {0: 1, 1: 1, 2: 17, 3: 133, 4: 674}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179967590_1179967600 5 Left 1179967590 21:44816471-44816493 CCGCCAGTGTCTGGCACTGAGCC 0: 1
1: 1
2: 4
3: 46
4: 361
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674
1179967585_1179967600 17 Left 1179967585 21:44816459-44816481 CCATCCCACTTCCCGCCAGTGTC 0: 1
1: 0
2: 1
3: 26
4: 297
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674
1179967589_1179967600 6 Left 1179967589 21:44816470-44816492 CCCGCCAGTGTCTGGCACTGAGC 0: 1
1: 0
2: 4
3: 41
4: 337
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674
1179967588_1179967600 12 Left 1179967588 21:44816464-44816486 CCACTTCCCGCCAGTGTCTGGCA 0: 1
1: 0
2: 4
3: 21
4: 264
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674
1179967584_1179967600 27 Left 1179967584 21:44816449-44816471 CCTGACGGTTCCATCCCACTTCC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674
1179967591_1179967600 2 Left 1179967591 21:44816474-44816496 CCAGTGTCTGGCACTGAGCCTCC 0: 1
1: 0
2: 0
3: 38
4: 305
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674
1179967587_1179967600 13 Left 1179967587 21:44816463-44816485 CCCACTTCCCGCCAGTGTCTGGC 0: 1
1: 0
2: 1
3: 13
4: 176
Right 1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG 0: 1
1: 1
2: 17
3: 133
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179967600 Original CRISPR CCTCATCTGTAAAGGGAGGG TGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900485623 1:2921290-2921312 ACTCAGCTGTGAAGGGAGAGGGG - Intergenic
900743738 1:4346056-4346078 CCCCATGTGTCGAGGGAGGGAGG + Intergenic
900748551 1:4378139-4378161 CCTCAGCTATAAAGGGAGATGGG + Intergenic
901113458 1:6818543-6818565 CCTCATCCAAAAAGGGCGGGTGG - Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902389007 1:16091952-16091974 CTCCATCTTTAAAGTGAGGGTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902793627 1:18785860-18785882 CCTAACCTGTCAAAGGAGGGAGG - Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903306708 1:22418000-22418022 CCTCATCTGTAAAGTGGGAGTGG + Intergenic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903809120 1:26024760-26024782 CCTCATCAGAAAAGTGAGGGAGG - Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
904008861 1:27378705-27378727 CCTCATCTGTAAAGGGGCAAGGG + Intergenic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904083326 1:27885774-27885796 CCTCATCTGTGCAGGGAAAGAGG - Intronic
904203666 1:28838450-28838472 CCCCATCTGTAAAGTGAGAGAGG + Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904573530 1:31486249-31486271 CCCCATGTGTCGAGGGAGGGAGG + Intergenic
905346952 1:37317879-37317901 CCTCATCTGTAAAGAGGTGATGG + Intergenic
905383667 1:37583517-37583539 CCTCATCGATAAAAGGAGAGGGG + Intronic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905852368 1:41283558-41283580 CCTTATCTGTAAAGTGGGGTGGG + Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906730811 1:48079571-48079593 CCTCATCTGTAAAACGATGGTGG - Intergenic
907696517 1:56735589-56735611 CCCCATGTGTCGAGGGAGGGAGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907820765 1:57965922-57965944 CATCATCTTTAAATGGCGGGGGG + Intronic
908439098 1:64135494-64135516 CATCATCTGTAATAGCAGGGGGG + Intronic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
909774162 1:79463841-79463863 CCTCATGTTTCGAGGGAGGGAGG - Intergenic
910487856 1:87735704-87735726 CCTCAACTATAAAATGAGGGGGG - Intergenic
910698974 1:90051697-90051719 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912942408 1:114056716-114056738 CTCCATCTGTAAAGAGAAGGAGG + Intergenic
913174584 1:116262342-116262364 CCTCATCTGTAAGGTGAAGGAGG + Intergenic
913937124 1:125065377-125065399 CCTCATCTGTTGAGGCAGGCAGG + Intergenic
915224452 1:154402275-154402297 CCTTATCTAAAAAGTGAGGGAGG + Intergenic
915270570 1:154750549-154750571 CTTCATCTGGGAAGGGTGGGGGG + Intronic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915479149 1:156173353-156173375 GCTCGTCTGTGAAGGGAGAGAGG + Intronic
916806322 1:168264945-168264967 CCTCATCTGTTAACAGAAGGAGG + Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920329017 1:205191482-205191504 GCTCGTCGGTAAATGGAGGGGGG + Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920779884 1:208978930-208978952 CCCCATATGTTGAGGGAGGGAGG + Intergenic
920801510 1:209192382-209192404 ACTCAAGTATAAAGGGAGGGGGG + Intergenic
920950457 1:210567385-210567407 CCTCATCTGGAAATTAAGGGAGG + Intronic
920971397 1:210746334-210746356 CCTCATCTGTAAAATGAAAGGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
921777945 1:219124784-219124806 CCTCACATGTAAATGGAGAGAGG - Intergenic
922131697 1:222786727-222786749 CTTCATTTGTTAAGGGAGGCTGG - Intergenic
922371234 1:224912163-224912185 CCTCACCTGAAAAGAAAGGGAGG - Intronic
923088889 1:230723031-230723053 CCCCATGTGTCAAGAGAGGGAGG + Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923961604 1:239090837-239090859 CCCCACATGTCAAGGGAGGGAGG + Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924571467 1:245241217-245241239 CCTAATCTGTGAAGTGAAGGTGG + Intronic
1063078529 10:2741584-2741606 CCCCACATGTCAAGGGAGGGAGG + Intergenic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065041976 10:21706398-21706420 CCTCATCTATAAAGTGAGGGTGG - Intronic
1065786079 10:29216449-29216471 CCTCATGTGTCAAGGGAGGGAGG + Intergenic
1066180798 10:32958572-32958594 CCTCCTCTGCGAAGGGCGGGAGG + Intronic
1067488268 10:46673110-46673132 CCTTTTCTGAAAAGGGAGAGAGG - Intergenic
1067606535 10:47668918-47668940 CCTTTTCTGAAAAGGGAGAGAGG + Intergenic
1067704408 10:48596373-48596395 TGTCATCTATAAAGGGAGAGGGG + Intronic
1068366662 10:56059499-56059521 CCCCACGTGTCAAGGGAGGGAGG + Intergenic
1068517374 10:58041011-58041033 CCCCATGTGTCAAAGGAGGGAGG - Intergenic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1068988988 10:63132236-63132258 CCTCAACTCTAAAGGCGGGGAGG - Intergenic
1069774377 10:70918270-70918292 GCTCATCTCTAAGGGGTGGGTGG - Intergenic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1069971564 10:72174816-72174838 CCTCCTCTGTAAAATAAGGGAGG + Intronic
1069976403 10:72216486-72216508 CCGCAGCTGTAACGGGGGGGGGG - Intronic
1070718630 10:78740675-78740697 CCACACCTGTAAAGGGATTGTGG + Intergenic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072630753 10:97144901-97144923 CCTCATCTGTAAAGTGTTGGGGG - Intronic
1072721373 10:97782931-97782953 TCTCATCTGTAAATGGAGTGGGG - Intergenic
1072785883 10:98282056-98282078 CCTCATGGGTCAAGGGAGGCTGG - Intergenic
1072792407 10:98327804-98327826 CCCCATCTGTAAAGCAAGGTGGG + Intergenic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073549302 10:104382612-104382634 CCCCATGTGTCGAGGGAGGGAGG + Intronic
1073834344 10:107423987-107424009 CTTCATCTGTAAAAGGATTGGGG - Intergenic
1073923989 10:108492887-108492909 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1073956810 10:108882227-108882249 CCTCATCAGGAAAGTGATGGGGG - Intergenic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1074109007 10:110409365-110409387 CCTCCTCTCTAAAGGGAGTAAGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074526194 10:114265478-114265500 CCTCCTCTGTAAAATAAGGGAGG - Intronic
1074690800 10:116002544-116002566 CCCCATGTGTCGAGGGAGGGAGG + Intergenic
1075097641 10:119483052-119483074 CCTCACGTGTGGAGGGAGGGAGG + Intergenic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1076065425 10:127444363-127444385 CCTCTGCTGCAAGGGGAGGGAGG - Intronic
1077252833 11:1568131-1568153 CCTCATCCGTTAAGTGGGGGTGG + Intronic
1077540077 11:3142518-3142540 CCTCATCTGTAAAAAGGGAGGGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078545055 11:12241145-12241167 CCTCCTCTGAAAAGGCAGGTAGG + Exonic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1080176036 11:29364442-29364464 CCTCATTTGTAAAGGTGAGGGGG - Intergenic
1080181264 11:29429217-29429239 CCTCATCAGTTAATGCAGGGAGG - Intergenic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081994223 11:47353123-47353145 CCTCATCTGTAAAGCGGGGTGGG + Intergenic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082790051 11:57340879-57340901 CCACCTCTGCAAAGGGAAGGAGG + Intronic
1082794841 11:57371454-57371476 GCTCAACTGTAGATGGAGGGCGG + Intergenic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083275542 11:61595078-61595100 TCTCATCTGTAAAGTAGGGGCGG + Intergenic
1083428237 11:62600684-62600706 CGTAATCTGTAAGGGAAGGGAGG + Exonic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1083988806 11:66233995-66234017 CCTCATCTGGAACAGGACGGTGG + Intronic
1084018811 11:66404650-66404672 CCCCATGTTTACAGGGAGGGAGG + Intergenic
1084692996 11:70737708-70737730 CCCCATCTGGAATGCGAGGGTGG + Intronic
1084940005 11:72607397-72607419 GCACATCTGGAAAGGGAGGGTGG - Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085638899 11:78178916-78178938 TCTCAGGTGGAAAGGGAGGGGGG + Intronic
1085793015 11:79512351-79512373 TCACAGCTGTAGAGGGAGGGAGG + Intergenic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086337055 11:85810847-85810869 CCTCCTCTGTTAAGTGAGGGAGG - Intronic
1086351319 11:85944959-85944981 CCTCATCTGTCAACAGAAGGAGG - Intergenic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1086989523 11:93287845-93287867 CCCCATTTGTTGAGGGAGGGAGG - Intergenic
1087155313 11:94896086-94896108 CCTCATCTGTAAATGATGGGTGG - Intergenic
1087812824 11:102626556-102626578 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1088512602 11:110593668-110593690 CCACAGCTGGAAAGTGAGGGGGG + Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089130955 11:116211543-116211565 CTTCAGCTGTTCAGGGAGGGAGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1090691994 11:129193297-129193319 CCTCATCTTTATGGGGGGGGGGG + Intronic
1090863769 11:130676946-130676968 CTTCATATGTGAGGGGAGGGTGG - Intronic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1092057467 12:5520011-5520033 TTTCATCTGTAAACGGTGGGTGG - Intronic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092549452 12:9482140-9482162 CCTCTTTTGTGAAGTGAGGGAGG - Intergenic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1094020269 12:25906485-25906507 CTTCATTTATAAAGTGAGGGAGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094244182 12:28268893-28268915 TCTCAGGGGTAAAGGGAGGGAGG - Intronic
1094521812 12:31199001-31199023 CCTCTTTTGTGAAGTGAGGGAGG + Intergenic
1095425923 12:42074646-42074668 CCTCATGTATCAAGGGAGGAAGG + Intergenic
1095552912 12:43465358-43465380 CCTCATCTGTAAATTGAGAGTGG + Intronic
1096100579 12:48968515-48968537 CTTCATTTCTAAAGGGAGGCAGG + Intronic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1098580702 12:72095484-72095506 CCTCATCTCTAAGGTGAGGAGGG - Intronic
1100059976 12:90563109-90563131 CCACATCTATAAAAAGAGGGAGG - Intergenic
1100383322 12:94082817-94082839 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1100551047 12:95646429-95646451 CTTCCTCTATAAAGGAAGGGAGG - Intergenic
1100717850 12:97324653-97324675 CGTCCTCTGCACAGGGAGGGAGG + Intergenic
1100810167 12:98329948-98329970 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
1100878686 12:98992393-98992415 CCCCATGTGTCAAGGGAGGGAGG + Intronic
1101496210 12:105256744-105256766 CCCCATGTGTCAAGGGAGGGAGG - Intronic
1101719800 12:107341482-107341504 CTTCAGCTGTTAAGTGAGGGAGG + Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102185064 12:110941429-110941451 GCTCATCTGTGAAACGAGGGTGG - Intergenic
1102352999 12:112208529-112208551 CATCATCTGCAATGGGAGGCGGG + Exonic
1102803323 12:115756585-115756607 CTTCATCTTGAAAGGGGGGGAGG + Intergenic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103594270 12:122014127-122014149 TCTTTTCTGTAAAAGGAGGGAGG + Intergenic
1103723807 12:122988165-122988187 CCTCATCTGGACACGGAGGCTGG + Intronic
1103831986 12:123787659-123787681 CCTCATCGGAAAAGGCAGAGCGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106633582 13:31503781-31503803 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1108186490 13:47893106-47893128 CCTCATCTGTAAAGTGAGTGAGG + Intergenic
1108428485 13:50329495-50329517 CCCCACGTGTCAAGGGAGGGAGG + Intronic
1108504795 13:51102990-51103012 CCCCACGTGTCAAGGGAGGGAGG - Intergenic
1109393541 13:61724836-61724858 CCTCACATGTAAAGAGAAGGAGG - Intergenic
1110586040 13:77194669-77194691 CCTCATCCATAAAAGGTGGGTGG + Intronic
1110733619 13:78909496-78909518 CCATATCTGTTAAGGGAGGATGG - Intergenic
1112521982 13:100104378-100104400 CCCCATGTGTTGAGGGAGGGAGG + Intronic
1113045637 13:106151859-106151881 CCCCACATGTCAAGGGAGGGAGG + Intergenic
1113150403 13:107257197-107257219 CCCCACATGTCAAGGGAGGGAGG - Intronic
1113414101 13:110114407-110114429 CCACATCTGTCACTGGAGGGTGG + Intergenic
1113482960 13:110635047-110635069 CCTCATCTGTAATGTGATGATGG + Intronic
1114375705 14:22144288-22144310 CTTCATGTGTAAAGGCAGGTTGG + Intergenic
1115217942 14:31030991-31031013 CCCCACGTGTCAAGGGAGGGAGG + Intronic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1116755416 14:48942050-48942072 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117500337 14:56344848-56344870 CCCCATGTGTCAAGGGAGAGAGG + Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118533274 14:66730920-66730942 CTTCATGTGTCAAGGGATGGAGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119862762 14:77948466-77948488 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120324176 14:83004694-83004716 CCCCATGTGTCAAGGGAGGGAGG - Intergenic
1120674614 14:87406452-87406474 CCTCACCTGTAAAGTGAGCACGG + Intergenic
1120707778 14:87762100-87762122 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
1120779089 14:88469726-88469748 GCTCATCTTTAACAGGAGGGTGG - Exonic
1120789727 14:88568594-88568616 CCCCACCTGTCAAGGGAGGGAGG - Intronic
1121043311 14:90768478-90768500 CCCCATGTATCAAGGGAGGGAGG - Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121374858 14:93399200-93399222 CCCCACATGTAGAGGGAGGGAGG - Intronic
1121484312 14:94302995-94303017 CCCCATGTGTCCAGGGAGGGAGG - Intergenic
1121828228 14:97028039-97028061 CCCCATCTGAAAATGGAGGCAGG + Intergenic
1121984666 14:98493138-98493160 CCTCATCTGTAAAGCAGGGATGG - Intergenic
1122146395 14:99691397-99691419 CCTCATCTGTAAACTGGGTGGGG + Intronic
1122313845 14:100814081-100814103 CCTCATCTGTAAAGCGGGCATGG + Intergenic
1122699996 14:103581916-103581938 CCTGCTCTGTGGAGGGAGGGTGG + Intronic
1122845991 14:104499431-104499453 CCCCATGTGTTGAGGGAGGGAGG - Intronic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1122979588 14:105185578-105185600 CTTCCTCTGTAAGGGGAGTGAGG + Intergenic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1124783308 15:32656273-32656295 CGTCATCTGGAAAAAGAGGGAGG + Intronic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1126046523 15:44646522-44646544 CCCCATGTGTCAAGGGAGGGAGG - Intronic
1126315374 15:47364022-47364044 CTTCATGTGTCGAGGGAGGGAGG - Intronic
1127539950 15:59927502-59927524 TCTCATCTGTAAAGGTAGATAGG - Intergenic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1127997006 15:64158961-64158983 CCTGTTCTGTACAGTGAGGGTGG - Intronic
1128108490 15:65061443-65061465 CTTCTTCTATAAAGGGAGGCTGG - Intronic
1128487327 15:68106737-68106759 CCTGATCTGTAGAGTGAAGGGGG + Intronic
1128674143 15:69596397-69596419 CCTCCTCTGTCAAAGGAAGGAGG - Intergenic
1128699660 15:69794929-69794951 CCTCATCTATTAAAAGAGGGAGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128777178 15:70329416-70329438 CCTCATGTCCAAGGGGAGGGAGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128910427 15:71508615-71508637 CCTCATCTGCAAAGTAAAGGGGG + Intronic
1128945109 15:71814499-71814521 CATCATTTGCAAAGGGAGAGAGG + Intronic
1129901775 15:79157045-79157067 CCACATCTGTAAAGGAGGGGTGG - Intergenic
1130519018 15:84648089-84648111 CCTTATCTGTGAAATGAGGGTGG - Intronic
1130759427 15:86803182-86803204 CCTCATGTGTCAAGGGAGGGAGG + Intronic
1130833591 15:87628134-87628156 CCTCTTTTGTAAAGGGAGCTGGG + Intergenic
1131439090 15:92445076-92445098 CCTCATCTCTCAAGGAATGGAGG - Intronic
1131677273 15:94683318-94683340 CCTCCTCTGTAAAAAGGGGGTGG - Intergenic
1131677841 15:94689375-94689397 CCCCATGTGTCCAGGGAGGGAGG + Intergenic
1131689752 15:94813950-94813972 CCACATCAAGAAAGGGAGGGAGG + Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132653087 16:1030431-1030453 CCGCATCTGTAAAGTGGGGGTGG + Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133890480 16:9874732-9874754 CTTCATATGTAACTGGAGGGAGG + Intronic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134137684 16:11690172-11690194 CCTCATTGGAAACGGGAGGGAGG - Intronic
1135045183 16:19149506-19149528 CCCCAGGTGTCAAGGGAGGGAGG + Intronic
1135380558 16:21992868-21992890 CCCCACCTGTGGAGGGAGGGAGG + Intronic
1135485872 16:22864145-22864167 CCTCAACTGAAAGGGCAGGGTGG - Intronic
1135938112 16:26798183-26798205 GCTCATCTCTACAGGGAGGCAGG - Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1136145689 16:28315171-28315193 TCTCATCTGTAAATGGAGAGAGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137801785 16:51268221-51268243 CCCCATGTGTAGACGGAGGGAGG - Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138408179 16:56815761-56815783 CCTTAGCTGTAAAGTGGGGGTGG - Intronic
1138537537 16:57667901-57667923 CCTCCTCTGTAAAGTGAAGATGG - Intergenic
1138683105 16:58701124-58701146 CCCCATGTGTCGAGGGAGGGAGG + Intergenic
1138776914 16:59734438-59734460 CCCCATGTGTGGAGGGAGGGAGG + Intronic
1138778199 16:59750838-59750860 CCCCACGTGTAGAGGGAGGGAGG - Intronic
1138918535 16:61498247-61498269 ACTCATAAGAAAAGGGAGGGAGG + Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139208382 16:65051637-65051659 CCCCAAGTGTGAAGGGAGGGAGG + Intronic
1139375563 16:66494380-66494402 CCTCATCTGTAAAGTGACTATGG + Intronic
1139400370 16:66676541-66676563 CCTCACCTGTAAAACAAGGGAGG + Intronic
1139851511 16:69953425-69953447 GCTCATCTGTAAACGGAGCAGGG - Intronic
1139880487 16:70176337-70176359 GCTCATCTGTAAACGGAGCAGGG - Intronic
1140372023 16:74419180-74419202 GCTCATCTGTAAACGGAGCAGGG + Intronic
1141344681 16:83233885-83233907 CCTCATCTATACAAGGAGTGTGG - Intronic
1141359351 16:83380929-83380951 CTTCCTCTGAGAAGGGAGGGAGG - Intronic
1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG + Intronic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142117479 16:88367310-88367332 CCTCATCTGTAAAGTGGGCTTGG - Intergenic
1142331974 16:89460897-89460919 CCTCTCCTGTAAGGGGTGGGGGG - Intronic
1142626162 17:1193445-1193467 CCTCTTCTGTAAAGCGGGCGTGG - Intronic
1143303468 17:5928017-5928039 CTCCATTTGTAAAGGGAAGGGGG + Intronic
1143416829 17:6756565-6756587 CCACACCTCTAACGGGAGGGGGG + Intronic
1144326767 17:14190037-14190059 CCTCTTCTGAAATGGGAGGAAGG + Intronic
1144416384 17:15051338-15051360 CTTCATCTGTAAAGAGAAAGGGG - Intergenic
1144475648 17:15586901-15586923 CCTCTTCTGAAATGGGAGGAAGG + Intronic
1144592688 17:16537831-16537853 CCACATCTCTAAAGAGAGAGAGG - Intergenic
1144620047 17:16812703-16812725 CCTCATCAGTTCAAGGAGGGAGG + Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764888 17:17727253-17727275 CCTCTTCTGTCAAAGGAGGGAGG - Intronic
1144892642 17:18503001-18503023 CCTCATCAGTTCAAGGAGGGAGG - Intergenic
1145035642 17:19538693-19538715 CCTCACATGTAAAAGAAGGGGGG + Intronic
1145139572 17:20441286-20441308 CCTCATCAGTTCAAGGAGGGAGG + Intergenic
1145796318 17:27657414-27657436 CCTCATCAGTTCAAGGAGGGAGG - Intergenic
1145810751 17:27762696-27762718 CCTCATCAGTTCAAGGAGGGAGG - Intronic
1145853286 17:28125119-28125141 CCTCTTCTATAAAGGAAGGGTGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147450214 17:40499706-40499728 CCTCAGCTGTCCCGGGAGGGCGG - Intronic
1148197724 17:45726737-45726759 CCCCACATGTCAAGGGAGGGAGG + Intergenic
1148335378 17:46837525-46837547 CCTTATTTGTAAAACGAGGGTGG - Intronic
1148553973 17:48566835-48566857 CCTCATCTGGAAAGTGTTGGGGG - Intronic
1148646316 17:49221516-49221538 CTTCATCTGTTAACGGAGAGTGG - Intronic
1148908404 17:50926416-50926438 CCTCATCTGCAAAGTGATTGAGG + Intergenic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1149060860 17:52420043-52420065 CCCCATGTGTCTAGGGAGGGAGG + Intergenic
1149203833 17:54220012-54220034 CCTCACCTCTAAAGGGAGGGGGG - Intergenic
1149226629 17:54478944-54478966 TCTCACCTGTGAAGGGGGGGTGG - Intergenic
1149346475 17:55741568-55741590 CCTCATCTGTAAAATGAAAGTGG + Intergenic
1149512884 17:57257130-57257152 CCTCACCAGGTAAGGGAGGGAGG + Exonic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150716443 17:67576335-67576357 CCTCATCTTTAAAGCAGGGGGGG + Intronic
1151306572 17:73266512-73266534 GCTCATCTGTAAAAGGGGTGAGG - Intergenic
1151890238 17:76947272-76947294 TCCCATCTGTAAAGGGACAGGGG - Intronic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1151935576 17:77258781-77258803 CCCCATGTGTCGAGGGAGGGAGG + Intergenic
1151999409 17:77636194-77636216 CCTCTTCTGTAAAACGGGGGTGG - Intergenic
1153519889 18:5941664-5941686 CCGCATCTGTAAAGTGAGGGTGG + Intergenic
1153750663 18:8226907-8226929 CCTCATCTCCAAAGGCAGGAAGG + Intronic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1155623068 18:27803251-27803273 CCCCACATGTAGAGGGAGGGAGG + Intergenic
1155623777 18:27811299-27811321 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
1155856635 18:30842911-30842933 CCCCACCTGTCCAGGGAGGGAGG + Intergenic
1155985653 18:32227946-32227968 CCCCATGTGTCAAGGGTGGGAGG + Intronic
1157011341 18:43652641-43652663 CCCCACATGTCAAGGGAGGGAGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157222619 18:45838574-45838596 CCACATCTGTATTGGGACGGGGG + Intronic
1157495955 18:48157711-48157733 CCTCATCTGTAAAAGCTGAGTGG + Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157597664 18:48873684-48873706 CCCCATCTGTAAAAGAAGGATGG + Intergenic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1158783731 18:60683423-60683445 CCTCAGGTGTCAAGGGAGGGAGG - Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159377166 18:67607033-67607055 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160344644 18:78123328-78123350 CCTCTGTTGTAAGGGGAGGGAGG - Intergenic
1160837935 19:1133258-1133280 CCTCCTCTGTGAGGGGAGGAAGG + Intronic
1161169195 19:2804634-2804656 CCTCATGTGTGAAGGGAGGAGGG - Intronic
1161631045 19:5355659-5355681 CCTCTCCTGTACAGGGAGTGAGG - Intergenic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163595852 19:18220703-18220725 CCTCATCTGTAATATGAGTGTGG + Intronic
1163791037 19:19306209-19306231 CCCCATCTGTAAAATCAGGGTGG - Intronic
1164004668 19:21137440-21137462 CCTGATCTCTAAAAGGAAGGTGG - Intergenic
1164629063 19:29749259-29749281 CCCCATCTGTGCCGGGAGGGCGG + Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165387753 19:35521414-35521436 CCTCCTGTATAAAGGGAGGCAGG - Intergenic
1165638438 19:37363611-37363633 CCTCATGTGTGCAGGGAGTGTGG + Exonic
1166254921 19:41596782-41596804 CCACATCTGTAAAGTGGGGCAGG + Intronic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166356999 19:42233200-42233222 CAGCACCTGTAAAGAGAGGGAGG + Exonic
1166395540 19:42437538-42437560 CCTGATTTGTGAAAGGAGGGTGG + Intronic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1166916277 19:46197862-46197884 CCCCATCTGTGATGGGAGGAGGG - Intergenic
1166972208 19:46576712-46576734 CCCCACCTGTTAAGGGAAGGAGG + Exonic
1167342150 19:48922301-48922323 CATCGTCTGGAAATGGAGGGAGG - Exonic
1167579325 19:50332583-50332605 CCTCCTCTCTAATGGGTGGGTGG - Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925635490 2:5937929-5937951 CCTCATCTGTAAAGTGACACAGG - Intergenic
926000422 2:9327137-9327159 TCTCAGCTGTAAAGGATGGGCGG - Intronic
926504786 2:13700025-13700047 CCCCATGTGTCGAGGGAGGGAGG + Intergenic
926940383 2:18129869-18129891 CCTCACCTGTAAATGGAAGTAGG + Intronic
927155953 2:20221833-20221855 CTTCAGCTCTACAGGGAGGGTGG - Intronic
927336224 2:21927892-21927914 CACCACCTGTCAAGGGAGGGAGG + Intergenic
927856589 2:26531374-26531396 CCCCATCTGTGAAAAGAGGGGGG + Intronic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
928848915 2:35718031-35718053 CCCCATGTGTGGAGGGAGGGAGG + Intergenic
929273551 2:40000545-40000567 CCTCATCTGTAAAGCAGGGATGG - Intergenic
929802192 2:45113839-45113861 CCCCATCTGTAAACGGCGGCTGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930309863 2:49726665-49726687 CCCCAGGTGTGAAGGGAGGGAGG + Intergenic
930483914 2:51988100-51988122 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
930694205 2:54394700-54394722 CCCCATGTGTGGAGGGAGGGAGG - Intergenic
931041560 2:58306026-58306048 CCCCATGTGTCATGGGAGGGAGG + Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931920496 2:67009905-67009927 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933782254 2:85810912-85810934 CCTCATCTGTAAAACCAGGGCGG - Intergenic
933799769 2:85951579-85951601 CCTTAGCTGTAAACTGAGGGTGG + Intergenic
935080281 2:99786247-99786269 CCTCATCTGTAAATGGGGACTGG + Intronic
935690504 2:105727202-105727224 CTTCATGTGTCAAGGGAGGGAGG - Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937343144 2:121104736-121104758 TCTCATGTCTGAAGGGAGGGAGG + Intergenic
937343415 2:121106396-121106418 CCCCATGTGTCGAGGGAGGGAGG - Intergenic
937983796 2:127629628-127629650 TGTCATCTGTAAGGGCAGGGAGG - Exonic
938246050 2:129778830-129778852 CCTCATCTGTAAAGTGGGTCTGG - Intergenic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
941992109 2:171567643-171567665 CCCCATATGTTGAGGGAGGGAGG - Intergenic
943763218 2:191632138-191632160 CTTCCTCTGGTAAGGGAGGGTGG - Intergenic
944635945 2:201676255-201676277 CCTCATTTCTAAAGTGAGGAAGG - Intronic
944721772 2:202429888-202429910 CCCCACGTGTCAAGGGAGGGAGG - Intronic
944941022 2:204626958-204626980 CCCCACCTGTCAAGGGAGGGAGG + Intronic
945542082 2:211100530-211100552 CCTCATGTGTCAAGGGAGAAAGG - Intergenic
945682179 2:212927263-212927285 ACTCTTCTGCAAATGGAGGGAGG - Intergenic
945733991 2:213575142-213575164 TCTTATCTGTAAAGTGAGTGAGG + Intronic
945916990 2:215714592-215714614 CATCATCTGTTCAGGGAAGGTGG - Intergenic
946182954 2:217959959-217959981 CCTCACGTGTGAAGGGAGGAGGG + Intronic
947137250 2:226987638-226987660 CCTCATCTGTACCCAGAGGGGGG - Intronic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948322370 2:237081056-237081078 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
948375199 2:237516425-237516447 CCTCATCACTACAGGAAGGGAGG - Intronic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168870653 20:1125391-1125413 CTTCATCTGTGAAGTGAGGTGGG + Intronic
1168927061 20:1590527-1590549 CCTCGCCTGTAAAAGGAGGTAGG - Intronic
1168934103 20:1648068-1648090 CCCCATCTGTAAAGGGGAGTTGG + Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169283747 20:4289931-4289953 CCTCATTTGTAAAGTGAGTCAGG - Intergenic
1169770050 20:9190271-9190293 CCCCACGTGTCAAGGGAGGGAGG + Intronic
1170496330 20:16928933-16928955 CCCCATGTGTCAAGGAAGGGAGG + Intergenic
1170907624 20:20530200-20530222 CCTCATCTGTGAAGTGGAGGTGG + Intronic
1171794252 20:29554200-29554222 CCTCACCAGTAAAAAGAGGGAGG - Intergenic
1171797381 20:29577110-29577132 CCACAGGTGTAAAGGGAAGGAGG + Intergenic
1171850870 20:30307051-30307073 CCACAGGTGTAAAGGGAAGGAGG - Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172662932 20:36579742-36579764 CCTTATCTGTAAAGGGGCAGGGG + Intronic
1172845018 20:37925031-37925053 CCTCATCTGTCAAGTGGGAGTGG + Intronic
1173431364 20:42989691-42989713 CTTCTGCTGTCAAGGGAGGGAGG - Intronic
1173493298 20:43500834-43500856 CCCCATGTGTCAAGGGAGAGGGG + Intergenic
1173542393 20:43863877-43863899 CCTCATCTCTAAAACGGGGGTGG + Intergenic
1174116133 20:48227651-48227673 CCTCATCTGTAAGTGGTGGGTGG - Intergenic
1174446895 20:50596577-50596599 ACTCATCTATCAAGGGAGGCAGG + Intronic
1174683563 20:52431600-52431622 CCCCACCTGTTGAGGGAGGGAGG - Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174897240 20:54462664-54462686 TCTGATCTGTGAAGGGAGAGAGG + Intergenic
1175169297 20:57068813-57068835 CCCTATCTGTAAATGGAGGAGGG + Intergenic
1175989133 20:62778854-62778876 CCCCATCTGTAAATGGAGACAGG - Intergenic
1176517393 21:7796254-7796276 CCTCATCTGTGAGGTGAAGGTGG + Intergenic
1177038186 21:16071466-16071488 CCTAATATGGAAAGGGGGGGGGG - Intergenic
1177084274 21:16682459-16682481 CCCCACGTGTAGAGGGAGGGAGG - Intergenic
1177351156 21:19943823-19943845 CCCCACATGTCAAGGGAGGGAGG - Intergenic
1177688006 21:24465371-24465393 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178651421 21:34426266-34426288 CCTCATCTGTGAGGTGAAGGTGG + Intergenic
1178687850 21:34725427-34725449 CCTCATGAGTAAAGGGTGTGGGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179000183 21:37450441-37450463 CCCCCTCTGTAAAGTGAGGTGGG + Intronic
1179298847 21:40088769-40088791 CCTCAGCAGTAAAAGGCGGGTGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180613680 22:17113837-17113859 GCTCATCTGTAAAGTGGGTGGGG + Exonic
1180814773 22:18782411-18782433 CCCCATCTGTAAAGCGAGTCAGG - Intergenic
1180904363 22:19398274-19398296 CTTCGTCTGTAAAAGGAGTGAGG - Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181727723 22:24823128-24823150 CCTCATCTGTAAAGTAAAGAGGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182134812 22:27891569-27891591 CCCCATGTGTCAAGGAAGGGAGG + Intronic
1182294528 22:29305313-29305335 CCTCATCAGGAAAGGAAGTGAGG - Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183228662 22:36567138-36567160 CCTCATCTGTAAAGCAGGGATGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183302832 22:37066678-37066700 CCTCTTCTGTAAAGTAGGGGTGG + Intronic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183738106 22:39654969-39654991 CCTCATCAGAAAAGGGGGGCAGG + Intronic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184293785 22:43511468-43511490 CCTCTTCTGTGAAGGTAGGTTGG - Intergenic
1184333184 22:43838721-43838743 CTTCATCTGTAAAGTGACCGCGG + Intronic
1184562829 22:45273359-45273381 TCTCCTCTGTAAAGCGGGGGTGG + Intergenic
1184604360 22:45563652-45563674 CCACATCTGTAAAACGAGAGGGG - Intronic
1184606255 22:45576414-45576436 CCTCACCTGTAAGGTGAGGAAGG - Intronic
1184660053 22:45961507-45961529 CCTCATCTGTAAGGTCAGGCTGG - Intronic
1185127602 22:49020158-49020180 TGTCCTCTGTGAAGGGAGGGTGG - Intergenic
1185335302 22:50268603-50268625 GGTCACCTGCAAAGGGAGGGTGG - Intronic
1203225957 22_KI270731v1_random:78688-78710 CCCCATCTGTAAAGCGAGTCAGG + Intergenic
1203264870 22_KI270734v1_random:8098-8120 CCCCATCTGTAAAGCGAGTCAGG - Intergenic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950502913 3:13375888-13375910 CCCCATCTGTAAAGTTGGGGGGG - Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950852151 3:16072268-16072290 CCCCATGTGTCGAGGGAGGGAGG - Intergenic
950920053 3:16685077-16685099 CCCCACATGTCAAGGGAGGGAGG - Intergenic
951636179 3:24780141-24780163 CCCCACATGTCAAGGGAGGGAGG - Intergenic
951755733 3:26088832-26088854 CCCCATGTGTCAAGGAAGGGAGG - Intergenic
951814992 3:26744575-26744597 CCCCACATGTCAAGGGAGGGAGG - Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953359323 3:42280977-42280999 CCCCACCTGTCGAGGGAGGGAGG + Intergenic
953916558 3:46924290-46924312 TCTCATCTGTATCTGGAGGGAGG - Intronic
953928239 3:46993205-46993227 CCTCATCTGTAAAAACAGAGGGG - Intronic
954326027 3:49864498-49864520 CCTCATCTGTAGTGCTAGGGGGG + Intronic
954399487 3:50311900-50311922 CCCCATCCGTGAGGGGAGGGGGG - Intronic
954471925 3:50705312-50705334 CCCCATGTGTTGAGGGAGGGAGG + Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954645592 3:52129682-52129704 CCTGGTCTTTCAAGGGAGGGAGG - Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955066815 3:55540600-55540622 CCCCATCTGTAAAACGAAGGAGG + Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
957257987 3:77863344-77863366 CCCCATGTGCCAAGGGAGGGAGG + Intergenic
957266948 3:77979623-77979645 CCCCATGTGTCTAGGGAGGGAGG + Intergenic
957425587 3:80035100-80035122 CCTCACGTGTCAAGGGAGGAAGG - Intergenic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
959738136 3:109684905-109684927 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960419491 3:117426404-117426426 TATCACCTGTAAAGGGAGGGAGG - Intergenic
960420082 3:117434677-117434699 CCTGATCTGTGAAGGAAGGCAGG + Intergenic
960973888 3:123157435-123157457 CCTCACGAGTAAAGGGAGAGGGG - Intronic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
962350921 3:134655075-134655097 CCTCATCTGTCAAGTGGGTGAGG + Intronic
963018105 3:140844953-140844975 CCCCACATGTCAAGGGAGGGAGG - Intergenic
963552292 3:146739542-146739564 CCTCAGCTGTATAGAGAGGAAGG - Intergenic
964339175 3:155690235-155690257 TCTCATCTATAAAAGGAGAGTGG + Intronic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
965809885 3:172580161-172580183 CATCACATGTCAAGGGAGGGAGG + Intergenic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966672380 3:182541697-182541719 CCTCATCAGAAAAGCAAGGGAGG + Intergenic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
967366028 3:188687387-188687409 CCCCACATGTCAAGGGAGGGAGG + Intronic
967519981 3:190417811-190417833 CCCCAAGTGTTAAGGGAGGGAGG - Intergenic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
967786485 3:193502534-193502556 CCTCATCTGTCATGAGAGGGTGG + Exonic
967946276 3:194806620-194806642 CCTCATCTGTAAAACAAAGGAGG + Intergenic
968234118 3:197021663-197021685 TATCATCTGTAAAGCGGGGGTGG + Intronic
968283925 3:197497128-197497150 TCTCATCTGTAAAAGAGGGGAGG + Intergenic
968969184 4:3784585-3784607 CCTCATCAGCAAAGCCAGGGAGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969981933 4:11166517-11166539 CCCCATCTTTAATGGGAGGGAGG + Intergenic
970113976 4:12672058-12672080 CCTCATATGTAGAGAGAGTGTGG - Intergenic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970270810 4:14345373-14345395 CCCCATGTGTCAAGGGAAGGAGG + Intergenic
972618186 4:40720691-40720713 CTTAAACTGTAAAGGGAAGGAGG - Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973897937 4:55434926-55434948 CATTATCTGAAAAGGGAGAGGGG + Exonic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
975854882 4:78613759-78613781 CCTCACCTGTAAAGCCAGGATGG + Intergenic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976545938 4:86335890-86335912 CCCCACATGTCAAGGGAGGGAGG - Intronic
976551721 4:86403798-86403820 CCCCATGTGTCAAGGGAGGGAGG - Intronic
976703687 4:87999533-87999555 CCCCACATGTCAAGGGAGGGAGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977455450 4:97254468-97254490 CCTCATCTGTAAGTTGAAGGTGG - Intronic
977722017 4:100250401-100250423 CCCCATGTGTCGAGGGAGGGAGG - Intergenic
979293438 4:119003372-119003394 CCCCACGTGTCAAGGGAGGGAGG - Intronic
979362613 4:119782835-119782857 CCCCATGTGTTAAGGGAGGGAGG - Intergenic
980254097 4:130353735-130353757 CCTCATCTGTAAAATGAAAGTGG + Intergenic
981294932 4:143120861-143120883 CCCCACGTGTCAAGGGAGGGAGG + Intergenic
982639099 4:157934171-157934193 CTTCATCTGTAAAGTAAAGGTGG + Intergenic
982990697 4:162270136-162270158 CATCATCTTTACAGGGAGAGAGG - Intergenic
983536994 4:168868309-168868331 GCGTATCTGTAAAGGGAGGGAGG + Intronic
983573071 4:169231073-169231095 CTTCATCTGTAAATAGAAGGTGG + Intronic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
984108273 4:175577395-175577417 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
984559310 4:181250209-181250231 CCTCCTCTATAATAGGAGGGAGG - Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985826276 5:2193944-2193966 CCTAATATGGAAAGGGAGGCTGG - Intergenic
985955414 5:3262039-3262061 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
986601423 5:9476997-9477019 CCCCATATATCAAGGGAGGGAGG + Intronic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
988131389 5:27111101-27111123 CATTATCTGTAAGGGGAGTGTGG - Intronic
988928430 5:36012471-36012493 CCCCATGTGTCAAGGGAAGGAGG + Intergenic
989082282 5:37635810-37635832 CCCCATGTGTCATGGGAGGGTGG + Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989303971 5:39929933-39929955 CCCCACGTGTCAAGGGAGGGAGG + Intergenic
990005712 5:50942019-50942041 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
990322438 5:54643079-54643101 TCTAAACTATAAAGGGAGGGGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990759338 5:59111077-59111099 ACTTTTCTTTAAAGGGAGGGAGG + Intronic
991498589 5:67252877-67252899 CCCCAGGTGTCAAGGGAGGGAGG + Intergenic
991605735 5:68398745-68398767 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
991972763 5:72156893-72156915 CCTCATCTGTAAAAGGGCAGTGG - Intronic
992068777 5:73130526-73130548 CCTGCTCTGTCAAGGCAGGGTGG - Intronic
992300142 5:75369569-75369591 CCTCATCTGTAAAACAGGGGTGG + Intronic
992478510 5:77127239-77127261 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
993448794 5:88047787-88047809 TCCCATGTGTCAAGGGAGGGAGG - Intergenic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
994174810 5:96700072-96700094 TCTCATCTGTAATAGGAGTGAGG + Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995525868 5:113050241-113050263 GCTCACCTTGAAAGGGAGGGAGG - Intronic
995608308 5:113881745-113881767 CCACATATGTCGAGGGAGGGAGG + Intergenic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
996752505 5:126903214-126903236 CCTCAACTGTAAATGCAGGAAGG + Intronic
997079737 5:130724200-130724222 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998292003 5:140925072-140925094 GCTCATCTGGAAAGGAAGGAAGG + Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998580944 5:143374972-143374994 TCTCATCAGTAAAGGGATGCTGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999722620 5:154410200-154410222 ACTCATCAGTAAATGGAAGGTGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000460846 5:161516353-161516375 CCTCATCTGCAAAGCAGGGGTGG - Intronic
1001131614 5:169069148-169069170 CCTCAACTGTAAATTGGGGGTGG - Intronic
1001233402 5:170009363-170009385 CCTGATCAGTAAAAGGATGGGGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002209402 5:177587707-177587729 CTGCATCTGGAAAGGGATGGAGG + Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002607363 5:180391071-180391093 CCCCATCTTTAAAGAGAGGCTGG + Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1002863047 6:1096912-1096934 CCTGTAATGTAAAGGGAGGGAGG + Intergenic
1002875837 6:1208086-1208108 ACCCATGTGTTAAGGGAGGGAGG + Intergenic
1003533124 6:6954247-6954269 CCTCATCTCTAAAACCAGGGTGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005533895 6:26735298-26735320 CCTCAGCTGTAAAGGGAATACGG + Intergenic
1005534626 6:26743384-26743406 CCCTAGCTGTAAAGGGAGTGTGG - Intergenic
1005536900 6:26766356-26766378 CCTCAGCTGTAAAGGGAATACGG - Intergenic
1005702397 6:28415054-28415076 CAGCAACTGTAAAGGGAGTGGGG - Intergenic
1005790338 6:29294223-29294245 CCCCATATGTTGAGGGAGGGAGG + Intergenic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006378575 6:33684981-33685003 CCTCCTCCAAAAAGGGAGGGAGG - Intronic
1006708055 6:36039167-36039189 TTACATCTGTAAAGGCAGGGAGG - Intronic
1007021661 6:38527406-38527428 CCCCACATGTCAAGGGAGGGAGG + Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1009929514 6:70160373-70160395 CCCCACATGTAGAGGGAGGGAGG - Intronic
1010618586 6:78045218-78045240 CCCCATATGTCAAGGGAGGGAGG - Intergenic
1012102783 6:95112192-95112214 CCTCATCTATAAAGGATGAGGGG + Intergenic
1012554552 6:100495707-100495729 CCCCATATGTCAAGGGAGGGAGG - Intergenic
1013019967 6:106204567-106204589 CCCCATGTGTCGAGGGAGGGAGG + Intronic
1013046577 6:106491647-106491669 CCACATATGGAAATGGAGGGAGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013521487 6:110937777-110937799 CTCCATCTGTAAACTGAGGGTGG + Intergenic
1013945515 6:115717743-115717765 CCCCACGTGTCAAGGGAGGGAGG - Intergenic
1014132000 6:117845861-117845883 CCCCATCTGGCAAGGGAGAGTGG - Intergenic
1014884161 6:126759205-126759227 CCTCATCTTTAATGGGGTGGTGG + Intergenic
1015178208 6:130334440-130334462 CCTCATCTGTAAAATGAAAGAGG - Intronic
1015585156 6:134768888-134768910 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1015759423 6:136642519-136642541 CCTCTTCTGTCAGGGGAGTGAGG - Exonic
1016251290 6:142046028-142046050 TGTCAGCTGTAAAGGGTGGGAGG - Intergenic
1017299257 6:152836348-152836370 CCCCACCTGTCGAGGGAGGGAGG - Intergenic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018570437 6:165204141-165204163 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
1019076732 6:169393975-169393997 CCGCAGCTGGGAAGGGAGGGAGG + Intergenic
1019102856 6:169646221-169646243 CCTCTTCTGTTAAGGGAGGATGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019918811 7:4150098-4150120 CCTTGTCTGTAAAGAGTGGGTGG - Intronic
1020222972 7:6255607-6255629 CCTCATCAAGATAGGGAGGGAGG + Intronic
1021071184 7:16243082-16243104 CCTGATGTGTCAAGGGAGGGAGG + Intronic
1021088762 7:16455712-16455734 CCACATTTGAAAAGTGAGGGAGG + Intergenic
1021403597 7:20238069-20238091 CCTGGTCTGAAAAGGGAGGAGGG + Intergenic
1021675646 7:23077863-23077885 CCTCATCTGTAAAACAGGGGTGG + Intergenic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022776995 7:33537084-33537106 CCTCAGCTGTTAAGTGAGGGAGG - Intronic
1023256970 7:38322255-38322277 CCTCATCTGTAGTGGGACCGGGG + Intergenic
1024542856 7:50493112-50493134 CCTCATCTGTAAAGAGAGCGTGG + Intronic
1025244884 7:57309385-57309407 CCTCATCTGTAAAGCAGAGGTGG - Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026664987 7:72334524-72334546 TTTCCTCTGTAAGGGGAGGGGGG - Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1027505486 7:79012729-79012751 TCTCATCTATAAAAGGAAGGTGG + Intronic
1028119993 7:87046576-87046598 CCCCACATGTCAAGGGAGGGAGG + Intronic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028622813 7:92843638-92843660 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
1028633846 7:92965224-92965246 CCTTATCTGTAAATGGTGTGGGG + Intergenic
1029342419 7:99956016-99956038 CCTCATCTGTAACAGGAAAGAGG + Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029658667 7:101944535-101944557 CCTCATCTGTGAAGTGAGAGGGG - Intronic
1030347329 7:108449364-108449386 CCTTTTCAGTGAAGGGAGGGGGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031279683 7:119782482-119782504 CCCCATGTGTTGAGGGAGGGAGG - Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034343551 7:150372352-150372374 TCGCAGCTGTAGAGGGAGGGGGG - Exonic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035160495 7:156946607-156946629 CTTCATCTCTAAAAGGAAGGGGG + Intergenic
1035756214 8:2034858-2034880 CCTCATCTGTAAGGTGAGCGTGG - Intergenic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1037298918 8:17431196-17431218 CCCCACGTGTCAAGGGAGGGAGG - Intergenic
1037829818 8:22180797-22180819 CCTCATCTGTAAAATAAAGGTGG - Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1038766089 8:30429147-30429169 CCTCATCTGTAAAGCAAGAAGGG - Intronic
1039762227 8:40590025-40590047 CCTCATCTAAAAAGGAAGGGAGG - Intronic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1040721624 8:50330897-50330919 CCTCACATGTCAAGGGAGGGAGG - Intronic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042202829 8:66298157-66298179 CCCCATGTGTAAAGGGAGATGGG + Intergenic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1042959560 8:74289026-74289048 ACCCATCTGTGAAGGGAGTGGGG + Intronic
1043492362 8:80762550-80762572 CCCCACATGTCAAGGGAGGGAGG - Intronic
1043674376 8:82931916-82931938 CATCATATGTAAATGGAGTGGGG + Intergenic
1043734281 8:83724378-83724400 CAACAACTGTAATGGGAGGGAGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044155923 8:88847145-88847167 TCTCAGCTGTAAAGGCAGGGTGG - Intergenic
1044544635 8:93445943-93445965 TCTCAGCTGCAAAGGAAGGGAGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045334029 8:101182258-101182280 CATCATCTGTAAAGTAGGGGTGG - Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045684931 8:104702221-104702243 CCTCACCTGTCGAGGGAGGGAGG + Intronic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1046239918 8:111476991-111477013 CCTCAGCTCTAAAGAGAGGACGG + Intergenic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1048160286 8:132014224-132014246 TCTCATCTGTAAAGTGAGCATGG + Intergenic
1048179546 8:132182487-132182509 CCTCATCTCCCCAGGGAGGGTGG + Intronic
1048207017 8:132423425-132423447 CATCATCTGAAAAGGCAGGAAGG + Intronic
1048338843 8:133523466-133523488 CCTCCTCTGTAAAGTGAAGATGG + Intronic
1048537597 8:135312116-135312138 CCCCATGTGTCGAGGGAGGGAGG - Intergenic
1048677401 8:136798974-136798996 TCTCATCTCTAAAAGGAGAGAGG + Intergenic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049161100 8:141098458-141098480 TCTCATCTGTAAAGTGGGTGGGG - Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1050976962 9:11950685-11950707 CATCACATGTCAAGGGAGGGAGG - Intergenic
1051522678 9:18007560-18007582 CCTTATTTGTAAAGCGAGGCAGG + Intergenic
1053172155 9:35895835-35895857 CCTCATTTGTACATGCAGGGTGG - Intergenic
1053418945 9:37964794-37964816 CTTCATCTGTACAGTGGGGGCGG - Intronic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053788649 9:41670343-41670365 CCACAGGTGTAAAGGGAAGGAGG - Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054156489 9:61644425-61644447 CCACAGGTGTAAAGGGAAGGAGG + Intergenic
1054176933 9:61881682-61881704 CCACAGGTGTAAAGGGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054476260 9:65575434-65575456 CCACAGGTGTAAAGGGAAGGAGG + Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054660601 9:67699124-67699146 CCACAGGTGTAAAGGGAGGGAGG + Intergenic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1054848656 9:69823293-69823315 CCCCATGTGTCAAGGGAGGTAGG - Intronic
1055401816 9:75932362-75932384 CCCTATCTGCAAAGGAAGGGTGG - Exonic
1055446539 9:76389339-76389361 TCTCGTCTGTAATGGGTGGGGGG + Intronic
1055530223 9:77177094-77177116 CCTCATCATTACAGGGTGGGAGG - Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1056270933 9:84947493-84947515 GCACATGTGCAAAGGGAGGGAGG + Intronic
1056343193 9:85659550-85659572 CCTCATTTGAAAAAGAAGGGAGG + Intronic
1056925432 9:90830415-90830437 ACTCATCTGCAAAGGGCTGGGGG - Intronic
1057292989 9:93818996-93819018 CCTCATCTGTCAAGTGCCGGTGG + Intergenic
1057400354 9:94717917-94717939 CCCCATGTGTGGAGGGAGGGAGG - Intergenic
1057849591 9:98555011-98555033 CCTCCTCTGTAAATGGACTGGGG + Intronic
1058604242 9:106703836-106703858 CCTCATTTGTAAGGGGATTGGGG - Intergenic
1058886013 9:109321323-109321345 CCTCTTCTGGAAAAGGAGAGGGG + Intergenic
1059299315 9:113299305-113299327 CCTGGTCTGGAAAGGTAGGGTGG + Exonic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1059586391 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG + Intergenic
1059668233 9:116469614-116469636 CTTCATCTCTAAAGTGAGAGGGG + Intronic
1059714065 9:116896855-116896877 CCACATGTGTCAAGGGAGGAAGG - Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060157447 9:121329483-121329505 CCTCATCTGTAAACTGGGAGTGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060513635 9:124251969-124251991 TCCCATCTGTAAAGTGAGGGTGG + Intergenic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061509595 9:131052566-131052588 CCTCAGCTGTACAGGGAGTGGGG - Exonic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062043126 9:134413149-134413171 CCTCATCTGTGATGGGCTGGGGG + Intronic
1062480024 9:136746798-136746820 ACTCTTCTGTGAAGGGAGGCGGG + Intronic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1185991790 X:4899478-4899500 CCCCACGTGTTAAGGGAGGGAGG - Intergenic
1186568189 X:10686685-10686707 CCACATCAGTAAAGAGAAGGGGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186815523 X:13234203-13234225 CCCCATATGTCGAGGGAGGGAGG - Intergenic
1187126781 X:16461879-16461901 TCTCAAATGTAAAGGAAGGGAGG + Intergenic
1187133469 X:16525261-16525283 CCCCATGTTTAAAGGGAGGAAGG - Intergenic
1187722990 X:22171359-22171381 CCCCATATGTCAAGGGAGGGAGG - Intronic
1188030303 X:25256151-25256173 CCCCATGTGTTGAGGGAGGGAGG + Intergenic
1189252407 X:39611537-39611559 TCTCATCTGTACAGCGAGTGGGG - Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1189377009 X:40474292-40474314 CCTCACCTGAGAAGGGAGGAGGG + Intergenic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1192099924 X:68253539-68253561 CCCCAACTGTAAAGTGAGGTGGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1194239263 X:91423604-91423626 ACTCATAAGTAAAGGCAGGGAGG + Intergenic
1194969871 X:100331623-100331645 CCCCACCTGTTAAGGGAGGGAGG + Intronic
1196167540 X:112551993-112552015 CTTCTTCTGGAAAGGGAGAGGGG - Intergenic
1196535753 X:116841534-116841556 CTTCACCAGTAAAGGGTGGGTGG + Intergenic
1196644451 X:118101704-118101726 CCCCATGTGTCAAGGGAGGGAGG + Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1198043222 X:132874898-132874920 CCTCCTCTGGAAGGGGGGGGCGG + Intronic
1198103068 X:133438590-133438612 CTTCATCTGTAAACTGAAGGTGG - Intergenic
1198388919 X:136154049-136154071 CCTCATCTGTAAAATAATGGGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198538595 X:137612089-137612111 CCCCATGTGTCAAGGGAGGGAGG + Intergenic
1199327286 X:146513823-146513845 CCCCATGTGTCAAGGGAGAGAGG + Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199812553 X:151365197-151365219 TCTCATCTGTAAAAGAAGGCAGG - Intergenic
1201567922 Y:15385807-15385829 CCCCATGTGTGGAGGGAGGGAGG + Intergenic
1201685361 Y:16695838-16695860 CCCCACATGTAATGGGAGGGAGG + Intergenic