ID: 1179972776

View in Genome Browser
Species Human (GRCh38)
Location 21:44845667-44845689
Sequence TTCCCGCCTGCTCAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179972766_1179972776 15 Left 1179972766 21:44845629-44845651 CCCCATTCTGTCTGGCTTCTGTG No data
Right 1179972776 21:44845667-44845689 TTCCCGCCTGCTCAGGAGGGAGG No data
1179972767_1179972776 14 Left 1179972767 21:44845630-44845652 CCCATTCTGTCTGGCTTCTGTGG No data
Right 1179972776 21:44845667-44845689 TTCCCGCCTGCTCAGGAGGGAGG No data
1179972769_1179972776 13 Left 1179972769 21:44845631-44845653 CCATTCTGTCTGGCTTCTGTGGA No data
Right 1179972776 21:44845667-44845689 TTCCCGCCTGCTCAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179972776 Original CRISPR TTCCCGCCTGCTCAGGAGGG AGG Intergenic
No off target data available for this crispr