ID: 1179975151

View in Genome Browser
Species Human (GRCh38)
Location 21:44861189-44861211
Sequence CTCAATTTACAAAGGGAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179975145_1179975151 2 Left 1179975145 21:44861164-44861186 CCAACAAACTCCCCAGCGTGCAG 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 227
1179975143_1179975151 4 Left 1179975143 21:44861162-44861184 CCCCAACAAACTCCCCAGCGTGC 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 227
1179975144_1179975151 3 Left 1179975144 21:44861163-44861185 CCCAACAAACTCCCCAGCGTGCA 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 227
1179975148_1179975151 -10 Left 1179975148 21:44861176-44861198 CCAGCGTGCAGAGCTCAATTTAC 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 227
1179975146_1179975151 -8 Left 1179975146 21:44861174-44861196 CCCCAGCGTGCAGAGCTCAATTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 227
1179975147_1179975151 -9 Left 1179975147 21:44861175-44861197 CCCAGCGTGCAGAGCTCAATTTA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179975151 Original CRISPR CTCAATTTACAAAGGGAAGC CGG Exonic
900781241 1:4618437-4618459 GACAATTTATAGAGGGAAGCAGG + Intergenic
903088858 1:20890814-20890836 ATCAATATACCAAGGTAAGCTGG + Intronic
906465263 1:46073230-46073252 CTCATTTGACAAAGGCAAGGTGG - Intronic
907360985 1:53914737-53914759 GTCAAGTTACAAAGGGTTGCTGG + Intergenic
909038525 1:70622778-70622800 TTCAATTTACATAGGGAACCAGG + Intergenic
909595520 1:77402230-77402252 TTCAAAATACAAAGGGTAGCAGG - Intronic
910688926 1:89946382-89946404 CTGAAGTTGCAAAGGCAAGCTGG + Intergenic
911413632 1:97542616-97542638 ATCAAGTTACAAAGGTAACCTGG - Intronic
913056775 1:115169423-115169445 CTCACTTTACAAATGGTATCAGG + Intergenic
915427826 1:155842108-155842130 CTTAAGTTCCAAAGGGGAGCGGG - Intronic
917380341 1:174399547-174399569 CTCAGATTACACAGGGAAGAAGG + Intronic
917650314 1:177069971-177069993 CTCAATTTACAAAAGTCAGTCGG - Intronic
919078257 1:192838258-192838280 ATGAATTTAAAAAGGGAAGGAGG + Intergenic
919440919 1:197632858-197632880 CTCAATAACCAAAGGGAAACTGG + Intronic
920274594 1:204794649-204794671 TCCAATTCAAAAAGGGAAGCAGG - Intergenic
921507062 1:215984499-215984521 TTTAATTTTCACAGGGAAGCTGG + Intronic
922050568 1:221986353-221986375 CCCAATTTACCAAGGGAAACAGG - Intergenic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
924090795 1:240498879-240498901 CTCAATTTACAAGGGGTGCCAGG + Intronic
924148703 1:241104882-241104904 CTCACTTTAAAAAGAGAAGAGGG + Intronic
1063673730 10:8121077-8121099 GTAAATTTTGAAAGGGAAGCAGG - Intergenic
1064324607 10:14338348-14338370 CTGAATCCACAAGGGGAAGCAGG + Intronic
1064361126 10:14665774-14665796 TTCAATTTGCACTGGGAAGCAGG - Intronic
1069470306 10:68682608-68682630 CTGAATTTACAAGGGAAGGCAGG - Intronic
1074632682 10:115275549-115275571 CTCAACTAACAAAGGCAAGGTGG - Intronic
1074842107 10:117364874-117364896 CTCATTTTACTAAGGGCAGAAGG + Intronic
1077630220 11:3806704-3806726 CTCATTTTACAATGGAAAACAGG - Intronic
1077702376 11:4454287-4454309 CACAATTTGCAAAGGGAGGAGGG - Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078648221 11:13162496-13162518 CTTACTTTACAAAGGAAAGAGGG - Intergenic
1079274824 11:19025498-19025520 CTTAATTTAAAGAGGCAAGCTGG - Intergenic
1080413667 11:32049893-32049915 AACAATTTAAAAAGAGAAGCTGG - Intronic
1081380275 11:42406599-42406621 CTCAGTTTTCAAATGTAAGCAGG + Intergenic
1082615383 11:55353941-55353963 CCTTATTAACAAAGGGAAGCTGG - Intergenic
1084113203 11:67026579-67026601 TCTAATTTTCAAAGGGAAGCTGG + Intronic
1084595003 11:70111640-70111662 GTGACTTTACAATGGGAAGCGGG + Intronic
1085070494 11:73539877-73539899 CTGAATTTCCCAAGGCAAGCAGG + Intronic
1087584931 11:100106560-100106582 TTCACTTTACAAAGGGATTCTGG - Intronic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088888579 11:114027056-114027078 GTCAATCTACAAAGGGACACAGG + Intergenic
1091000209 11:131904674-131904696 CTCACTTTACAATGGGATGGAGG + Intronic
1091552788 12:1549581-1549603 CTTAAATTTAAAAGGGAAGCAGG + Intronic
1093196556 12:16136330-16136352 TGCAATTTACAAAGGTAAACAGG - Intergenic
1094326945 12:29250974-29250996 CTCAATTTTCAAAGAGGAGGTGG + Intronic
1095862617 12:46934837-46934859 ACCTATGTACAAAGGGAAGCAGG + Intergenic
1097288196 12:57893655-57893677 CCCAAGTAACAAAGGGATGCTGG - Intergenic
1098579266 12:72079664-72079686 TTCAATTTATAAAGTGAAGTAGG + Intronic
1098655623 12:73026042-73026064 CCCATTTTACAAACGGAAACAGG - Intergenic
1099578927 12:84416744-84416766 CTCAATTTTGAAAAGGAAGTTGG - Intergenic
1100187091 12:92150451-92150473 CTAAATTGACAAAAGGAACCAGG + Intergenic
1103496904 12:121369992-121370014 CTCAATTTAAAAAGAGAAAGGGG - Intronic
1104680032 12:130743766-130743788 CTGAATTCAGAATGGGAAGCAGG - Intergenic
1105684038 13:22759952-22759974 CTAAATTCAGAAAGGGAAGTGGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1109790059 13:67234390-67234412 ATCAAATCACAAAGGAAAGCAGG + Intergenic
1112593093 13:100782455-100782477 CTCTGCTTACAAAGGGAAGGAGG + Intergenic
1113155034 13:107310602-107310624 CTCAATATACAAAGAAAACCAGG - Intronic
1114534100 14:23412223-23412245 CTCTATTTAAAAGGGGATGCAGG + Intergenic
1114684439 14:24514687-24514709 CTTCATTTACAAAGGGAAGTGGG + Intergenic
1115402256 14:32975325-32975347 CTCAGTCTAAAAAGGGAAGGAGG - Intronic
1116886684 14:50229052-50229074 CTCATTTTACAAAGACAAGGTGG + Intronic
1118071132 14:62247694-62247716 GTCACTTTTCAAAGGCAAGCAGG + Intergenic
1119166601 14:72499881-72499903 TTCTATTTAGAAAGGGAACCAGG - Intronic
1120562831 14:86017990-86018012 CTCAATTGCCAAAGGCAAGATGG - Intergenic
1125154290 15:36568728-36568750 CTCATTTTACAAAGTAAAGTAGG + Intergenic
1128549385 15:68588424-68588446 CTCACTTTTCAAATGAAAGCAGG - Intronic
1128781713 15:70362814-70362836 CTCAAATCACAAAGGCATGCTGG + Intergenic
1130882818 15:88069808-88069830 CTGAACTCACAGAGGGAAGCTGG + Intronic
1131272550 15:90956071-90956093 TTCAGTTTACAAAGGGAGGTGGG - Intronic
1131792966 15:95984679-95984701 TTCATTCTCCAAAGGGAAGCTGG - Intergenic
1132781903 16:1631464-1631486 ACCACTTTGCAAAGGGAAGCTGG - Intronic
1133109651 16:3540143-3540165 CCTAATTTACAAAGGGAAAAAGG - Intronic
1133120972 16:3607482-3607504 CTCAGTATACCAAGGGCAGCAGG + Intronic
1133472730 16:6091342-6091364 CTGCATTTACATAGGGAAGGGGG - Intronic
1138612684 16:58139683-58139705 CTCAATTTAAAAAGGAAGGAAGG - Intergenic
1139280624 16:65767332-65767354 ATCAGGTTACAAAGGGATGCAGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1142975447 17:3641054-3641076 CTCATCTTACAAGGGGATGCTGG - Intronic
1143303468 17:5928017-5928039 CTCCATTTGTAAAGGGAAGGGGG + Intronic
1143626733 17:8114567-8114589 GTCAATTTTCATGGGGAAGCCGG + Exonic
1144783939 17:17821603-17821625 CTCAGTTTACAGGGGGAAGAGGG + Intronic
1146321849 17:31853031-31853053 CTAAATTGACAAAGAGAAGATGG + Intronic
1150161619 17:62902774-62902796 CTTAATTTACAAAACAAAGCAGG - Intergenic
1150785800 17:68161888-68161910 CTACATTTATAAGGGGAAGCTGG + Intergenic
1151402396 17:73864355-73864377 CTTCATTTACAGATGGAAGCTGG + Intergenic
1152746329 17:82041442-82041464 CACAACTACCAAAGGGAAGCGGG + Intergenic
1153383354 18:4463632-4463654 CTTAATTTACACAGGGAATGTGG + Intergenic
1153476310 18:5502406-5502428 ATCAATATACAAAGTGAAGCAGG - Intronic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156624941 18:38897423-38897445 CTCAAATTACAACGGGAAAATGG + Intergenic
1156878132 18:42041574-42041596 TTTTTTTTACAAAGGGAAGCAGG - Intronic
1156885114 18:42126311-42126333 CTCATTTTACATATGGAAACAGG + Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1160732469 19:647521-647543 CACTACTTACAAAGAGAAGCCGG - Exonic
1162256335 19:9493046-9493068 CTCAACTACCAAAGGGAAACTGG + Intronic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1162352140 19:10157310-10157332 CTCAATTTAGAAAATAAAGCAGG + Intronic
1164474429 19:28564207-28564229 CTCCATTAATAAATGGAAGCTGG - Intergenic
1165312752 19:35038923-35038945 CTCGAGTTACACAGGGAGGCAGG + Intronic
1166180809 19:41107259-41107281 CTCAAGTTAAAAAGGGGAGATGG + Intergenic
1168089881 19:54075492-54075514 CCCATTTTAAGAAGGGAAGCGGG + Intronic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929457924 2:42079123-42079145 TTCACTTTAGAAAGGGAATCGGG - Intergenic
929712299 2:44277631-44277653 CTCAATGTGCAAAAGGCAGCAGG - Intronic
930364411 2:50421328-50421350 CTCCATTTAGAAAGTGAAGGGGG - Intronic
934030795 2:88044532-88044554 CTCAATTTAAAAAGGGCAAAAGG + Intronic
936000433 2:108822940-108822962 CTCAAATTAGAAAGGAAAGAAGG + Intronic
936066769 2:109338392-109338414 CTCAAATGACAAAAGGAAGGAGG - Intronic
938687905 2:133758982-133759004 CCCAAGTTCCAAAGGCAAGCAGG + Intergenic
939995789 2:148918302-148918324 TTCAATTTATGAAGGGAATCTGG - Intronic
940114285 2:150191217-150191239 CTCATTTTAAAAAGGGACACAGG - Intergenic
940277998 2:151959506-151959528 CTGCATTTACATAGAGAAGCTGG - Intronic
943509249 2:188803517-188803539 CTCAATTGTCAAAGGCAAGGTGG + Intergenic
943746779 2:191470100-191470122 CACTATTTAAAAAAGGAAGCAGG - Intergenic
945791444 2:214310537-214310559 CTCAATATCCAAAGGGAAACTGG - Intronic
945982737 2:216327113-216327135 CAAAATTTAAAAAGGGAGGCAGG - Intronic
946099106 2:217303513-217303535 CTGAATTTGCATTGGGAAGCAGG + Intronic
1169840938 20:9936482-9936504 CTTTATTTATAAAGGGATGCTGG + Intergenic
1170414175 20:16122381-16122403 CTCTATTTCCTAAGAGAAGCAGG + Intergenic
1170764525 20:19278835-19278857 CTAAATTTACATGTGGAAGCAGG + Intronic
1172806386 20:37615029-37615051 CTGAGTTTACAATGGGATGCAGG - Intergenic
1175453736 20:59093884-59093906 CTCACTTTACAGCGAGAAGCTGG + Intergenic
1179975151 21:44861189-44861211 CTCAATTTACAAAGGGAAGCCGG + Exonic
1183016430 22:34991697-34991719 CACAATGTACTAAGGAAAGCAGG + Intergenic
1185408316 22:50670036-50670058 CTCAATTTAGAAAAAGAATCAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950898540 3:16475531-16475553 CCCAATTTCCACAGGGAAACTGG + Intronic
954468506 3:50672891-50672913 CTCGATTTTCAGAGGCAAGCTGG + Intergenic
954563609 3:51579577-51579599 CTCAATTCACAAAGGAAGACAGG - Intronic
954841031 3:53511822-53511844 CTCAAAATACAAAGGGATACAGG + Intronic
955712786 3:61797603-61797625 CTTGATTTACAAAGGAAGGCGGG - Intronic
956496764 3:69835304-69835326 CTCAATTAAAAAATAGAAGCTGG - Intronic
959469276 3:106729605-106729627 CTCAATATTCAAAGAAAAGCTGG + Intergenic
960555533 3:119025311-119025333 CTCATTTTGCAAATGAAAGCAGG + Intronic
961765772 3:129209546-129209568 CTAAATTTACAAAAGTTAGCTGG + Intergenic
963255867 3:143144539-143144561 CTTAATCTACAAAGGGAAATTGG - Intergenic
963682755 3:148400619-148400641 CTCAAGTTTCACAGGGAAGTGGG + Intergenic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
965004156 3:162996213-162996235 CTCAATTTTCATAGGTAATCTGG - Intergenic
966466330 3:180234305-180234327 TTCAGTTTTAAAAGGGAAGCAGG - Intergenic
966678888 3:182619323-182619345 CTTAATTTAAAAAGGGGTGCCGG + Intergenic
970856504 4:20655336-20655358 TTTTATTTACAAAGGGATGCTGG - Intergenic
971160292 4:24126944-24126966 GTCCTTTTACAAATGGAAGCTGG - Intergenic
971551901 4:27967909-27967931 CTCTAGCCACAAAGGGAAGCTGG + Intergenic
973213262 4:47639556-47639578 CTGAATGTACAAAGGCAGGCTGG + Intronic
974310040 4:60193658-60193680 CACAATTTAAAAAGTGAAACAGG - Intergenic
974806038 4:66882384-66882406 CTTATGTTTCAAAGGGAAGCAGG + Intergenic
974849467 4:67387388-67387410 CGCATTTTAAAAAGGAAAGCTGG - Intergenic
975752230 4:77535674-77535696 CCCAATTTACCAAGGTAAGGAGG + Intronic
976089592 4:81442373-81442395 CTCCATTTCAAATGGGAAGCTGG - Exonic
976605499 4:86978894-86978916 TTCTATTTAAAAAGGGAAGTGGG - Intronic
976924275 4:90477410-90477432 TTCAATTTTCAAAGTAAAGCAGG + Intronic
977465769 4:97381627-97381649 CTCAACTGTCAAAGGCAAGCTGG + Intronic
978134622 4:105242393-105242415 CACAATTTAGAAAAGGAGGCTGG - Intronic
979039620 4:115772272-115772294 GTCATTTTACAAAGGGCAACAGG + Intergenic
980025700 4:127763729-127763751 TTTAAATTACAAAGTGAAGCTGG + Intronic
980497764 4:133607154-133607176 CTCAACTGACAAAGGCAAGGTGG - Intergenic
982043807 4:151421667-151421689 CTCAATTAACAAAGAGATTCGGG - Intronic
982515694 4:156346212-156346234 TTCTATTTACAAAATGAAGCAGG + Intergenic
987118586 5:14745750-14745772 TTAACCTTACAAAGGGAAGCAGG + Intronic
987954185 5:24716654-24716676 TTCAATTGACAAAGGGAACAAGG - Intergenic
992092113 5:73326645-73326667 TTCAATTTCCAAAGGGAGGACGG + Intergenic
993232129 5:85249322-85249344 CTCAACTGACAAAGGCAAGGTGG - Intergenic
995070570 5:107916457-107916479 CTGTATTTACAAAGTTAAGCAGG - Intronic
995245571 5:109931581-109931603 CTCAATCTTCAAAGGGATACAGG - Intergenic
995285686 5:110385732-110385754 CTAAATTCCAAAAGGGAAGCGGG - Intronic
996138402 5:119873921-119873943 CTCAATTTCCAAAGGTAAGGAGG + Intergenic
997154125 5:131533643-131533665 TTCATTTTGCAAAGGGAAGCTGG + Intronic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
997852019 5:137341390-137341412 CTCACTGTACAAAGAGAATCAGG + Intronic
998768533 5:145515555-145515577 CCCGAGTTACAAAGAGAAGCTGG + Intronic
1000196445 5:158963637-158963659 CCCAAGTTACAAAGGGGATCAGG - Intronic
1004355074 6:14923541-14923563 CTTAAATCACAAAGGGAAGAAGG + Intergenic
1004410083 6:15373005-15373027 TTCATTTTAGAAATGGAAGCAGG - Intronic
1006575835 6:35044967-35044989 GTCAAGTTACAGAGGGAAACAGG + Intronic
1009733891 6:67649194-67649216 CTCAAAATACAAAGAGAAGAAGG - Intergenic
1012530914 6:100235288-100235310 CTCTCTTTACAAAAGGAAGAGGG + Intergenic
1013384769 6:109615477-109615499 GTCAACTTACAAACTGAAGCTGG - Intronic
1013887643 6:114989235-114989257 CTCCATCTACAAACGGTAGCTGG - Intergenic
1014659994 6:124157870-124157892 CTCACTTTAAAAAGATAAGCAGG - Intronic
1015772959 6:136787617-136787639 GTGAATTTACAAAGGCAAGGTGG - Intronic
1015884255 6:137900161-137900183 CTCAACAGAGAAAGGGAAGCTGG + Intergenic
1017179399 6:151536131-151536153 CTCAAAGTTCAAAGGGAAGCAGG - Intronic
1017605242 6:156126546-156126568 CTGTAATTAGAAAGGGAAGCAGG - Intergenic
1017711599 6:157173919-157173941 CACAAGTTACAGAGTGAAGCAGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1021612400 7:22471020-22471042 CTCAATTTAAAGATGAAAGCAGG - Intronic
1022261595 7:28710773-28710795 CTCATTTTAGAAAGGAAAACTGG - Intronic
1022972818 7:35532786-35532808 CTTCATTTTCTAAGGGAAGCTGG - Intergenic
1023601116 7:41882718-41882740 TTCAAATTGCAAGGGGAAGCTGG + Intergenic
1026028296 7:66765830-66765852 CTCAATCCACAAAGATAAGCTGG - Intronic
1026251283 7:68673259-68673281 CTCAATTAAAAAAGGGAGGTTGG - Intergenic
1028111570 7:86948524-86948546 CTAAATATAAAAAGGGAAACAGG + Intronic
1028291268 7:89067676-89067698 AAAATTTTACAAAGGGAAGCAGG + Intronic
1029161112 7:98552700-98552722 CTCTCTTTCCAAAGGGAGGCTGG + Intergenic
1029682296 7:102119909-102119931 CTCCATTTGCTAAGAGAAGCGGG - Intronic
1030110137 7:106019923-106019945 TTCCATTTACAAGGGGCAGCAGG + Intronic
1034152488 7:148928038-148928060 CTAAATTTAAAAAGGGAATTGGG + Intergenic
1034169830 7:149054369-149054391 CTCAATTGTCAAAGGCAAGGTGG + Intergenic
1035266186 7:157691435-157691457 CTCCCTTTCCAAATGGAAGCAGG + Intronic
1035828638 8:2670824-2670846 TTCAATTTACAAAGCAAAGATGG + Intergenic
1038015542 8:23511363-23511385 CTCATTTTACTAAGGAGAGCTGG + Intergenic
1038174261 8:25165977-25165999 CTCATTTAACAAATGGAGGCCGG + Intergenic
1039057400 8:33547909-33547931 TACTATTTACAAAGGGAAGGAGG + Exonic
1042556776 8:70039923-70039945 CTCAATTAACAAAGAAAAGGGGG + Intergenic
1042716493 8:71778875-71778897 CACAATTTCCCAGGGGAAGCAGG - Intergenic
1043034210 8:75177068-75177090 TTTAATTTACAAAGGAAAGTGGG + Intergenic
1045365114 8:101468915-101468937 CTCTATTTACAAATGGAAATTGG - Intergenic
1045372254 8:101536027-101536049 CACAATTTAGACAGAGAAGCAGG + Intronic
1048134614 8:131736517-131736539 CCCACTTTACAAAGGAAAACAGG + Intergenic
1048522907 8:135173400-135173422 CTTTATTTACAAAGAGAAGTGGG + Intergenic
1050292656 9:4172302-4172324 CTCCATTCCTAAAGGGAAGCAGG + Intronic
1051966182 9:22832456-22832478 CTCAACTGTCAAAGGGAAGGTGG + Intergenic
1052321671 9:27174061-27174083 CTTATTTTACAAAGGGCAGAGGG - Intronic
1053447480 9:38164185-38164207 CTCACTGTGCAAAGGGAAGCAGG + Intergenic
1055994172 9:82139675-82139697 CTCTATTTCCTAAAGGAAGCAGG - Intergenic
1056429335 9:86511767-86511789 CTCCATTTACAAATGGGAGATGG + Intergenic
1057310031 9:93936918-93936940 CTGAATCTTGAAAGGGAAGCAGG + Intergenic
1058874853 9:109235315-109235337 CTAAGTTTACAAAGGGAAAGGGG - Intronic
1058880322 9:109279994-109280016 TGCAATTTACAAAGAGAAGTAGG - Intronic
1058912268 9:109532193-109532215 CTCAAAAGACAAATGGAAGCTGG + Intergenic
1060580822 9:124744960-124744982 CTCCATATAAAAAGGGAAGATGG + Intronic
1188001198 X:24983942-24983964 CTCATTTTGCAGACGGAAGCAGG - Intronic
1191987543 X:66998820-66998842 GACATTTTACAAAAGGAAGCGGG - Intergenic
1193873777 X:86834857-86834879 ATTCATTGACAAAGGGAAGCAGG - Intergenic
1194280958 X:91953722-91953744 CTCTATTTACACTGGGAATCAGG + Intronic
1194398786 X:93418557-93418579 CTCATTTCACAAAGGTAAGGTGG - Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1196292890 X:113964504-113964526 CTCAATTTTCCAAGGGGATCAGG - Intergenic
1196697484 X:118628897-118628919 CTCAATTTACAAATGAAAATTGG + Intronic
1197189835 X:123633796-123633818 CTCAATTTCAAAAGGGGGGCAGG + Intronic
1197313787 X:124938997-124939019 CACAACTTAAAAAGGGAGGCGGG + Intronic
1198227419 X:134658331-134658353 CCAAATTTCCAAAGGGAAGAAGG + Exonic
1200598550 Y:5178382-5178404 CTCTATTTACACTGGGAATCAGG + Intronic
1200862347 Y:8006420-8006442 CTAAAATTACCAAAGGAAGCAGG + Intergenic
1202246028 Y:22821209-22821231 CTAAAATTACTAAAGGAAGCAGG - Intergenic
1202399016 Y:24454957-24454979 CTAAAATTACTAAAGGAAGCAGG - Intergenic
1202471764 Y:25215129-25215151 CTAAAATTACTAAAGGAAGCAGG + Intergenic