ID: 1179975494

View in Genome Browser
Species Human (GRCh38)
Location 21:44863390-44863412
Sequence TGTGCTCTTGGGCACACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179975494_1179975501 4 Left 1179975494 21:44863390-44863412 CCTCCTGTGTGCCCAAGAGCACA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1179975501 21:44863417-44863439 CACACGCCTGGAGCTACTGTAGG 0: 1
1: 0
2: 0
3: 5
4: 111
1179975494_1179975502 5 Left 1179975494 21:44863390-44863412 CCTCCTGTGTGCCCAAGAGCACA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1179975502 21:44863418-44863440 ACACGCCTGGAGCTACTGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1179975494_1179975498 -8 Left 1179975494 21:44863390-44863412 CCTCCTGTGTGCCCAAGAGCACA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1179975498 21:44863405-44863427 AGAGCACACCCACACACGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 204
1179975494_1179975504 12 Left 1179975494 21:44863390-44863412 CCTCCTGTGTGCCCAAGAGCACA 0: 1
1: 0
2: 2
3: 21
4: 250
Right 1179975504 21:44863425-44863447 TGGAGCTACTGTAGGGCAAGCGG 0: 1
1: 0
2: 1
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179975494 Original CRISPR TGTGCTCTTGGGCACACAGG AGG (reversed) Intronic
900955098 1:5881929-5881951 TGTGCTCGTGCGCAGACAGTAGG - Intronic
901305041 1:8226760-8226782 TGTGCCACTGGGGACACAGGGGG + Intergenic
902256551 1:15192982-15193004 TGTCCCCCTGGGCCCACAGGAGG + Intronic
902409264 1:16203300-16203322 TTTCCTCTTGGGCAAACTGGTGG - Intronic
903563786 1:24249067-24249089 TCTTCTCCTGGGCACACAGCTGG - Intergenic
904401082 1:30257152-30257174 TGTGAGCTTGGGCACCAAGGGGG - Intergenic
905268765 1:36772977-36772999 AGTTCTCTTGGGCACAGAGTAGG + Intergenic
905551851 1:38847919-38847941 TGTGCTCCTGGCTACACAGGAGG + Intronic
906107534 1:43303900-43303922 TGTGCTTTTGAGCACAGAGAAGG - Intronic
906522979 1:46478112-46478134 TGTGCTAATTGGCACAGAGGAGG + Intergenic
908054190 1:60265398-60265420 TATGCTCTTGGGCCCCAAGGAGG + Intergenic
909456443 1:75855157-75855179 TGTGGTCTTGGCTACTCAGGCGG - Intronic
910245498 1:85134237-85134259 TCTGTTCAAGGGCACACAGGTGG - Intergenic
910344244 1:86217463-86217485 TGTCCCCTTGGGGACTCAGGAGG + Intergenic
911126102 1:94342488-94342510 TGTGCCCTTGGGCTCCCAGCTGG + Intergenic
915204459 1:154259753-154259775 TGTGCTCATGGCCAGGCAGGGGG + Intronic
915507121 1:156364880-156364902 TGTGCTATCTGGCACACAGTAGG + Intronic
917475106 1:175362659-175362681 TGTACTCTTGTGCACACAGGTGG - Exonic
917878212 1:179306288-179306310 TGTCCTCCTGGGCCCACTGGAGG - Intronic
919522747 1:198609443-198609465 ATTCCTCTTGGGCACACAGGTGG - Intergenic
921242876 1:213204743-213204765 TGTGGTCCTGGCTACACAGGAGG - Intronic
922744933 1:228038317-228038339 TTTGCTGTGGGGCACACAGGGGG - Intronic
923128888 1:231057554-231057576 AGGGCTCTTGGGGACATAGGTGG + Intergenic
923304419 1:232675107-232675129 GGTGCTCTTGGGAGCAGAGGCGG - Intergenic
924934435 1:248756151-248756173 TATGCTCATGGGCACACAGCCGG + Intergenic
1062835534 10:633280-633302 CAGGCTCTTGGGTACACAGGCGG - Intronic
1062901887 10:1152805-1152827 TGTGCCCCACGGCACACAGGAGG + Intergenic
1062901909 10:1152885-1152907 TGTGCCCCACGGCACACAGGAGG + Intergenic
1064032821 10:11893991-11894013 GGAGCTCTAGGGCCCACAGGAGG + Intergenic
1064353977 10:14601577-14601599 TGTGCTGTGGGGCACACTCGGGG - Intronic
1066125510 10:32337975-32337997 TGTGCTCTGGGACTCAGAGGAGG - Intronic
1067141043 10:43657132-43657154 TGTGCACATGTGGACACAGGAGG + Intergenic
1067456281 10:46421468-46421490 TTTGCTCATGGCCACACAGCAGG + Intergenic
1067630918 10:47963171-47963193 TTTGCTCATGGCCACACAGCAGG - Intergenic
1068602284 10:58968555-58968577 GGTGCTCTTGGGGACCTAGGAGG + Intergenic
1069678488 10:70266677-70266699 TAGCCTCTGGGGCACACAGGAGG - Intronic
1070534742 10:77367441-77367463 GGGGCTCTTGGGAACACAAGTGG - Intronic
1070825203 10:79386734-79386756 TGAGTCCTAGGGCACACAGGTGG + Intronic
1072063351 10:91839262-91839284 TGTGCTCTTTGGTTCAGAGGAGG - Intronic
1074145766 10:110715926-110715948 TTTTCTTCTGGGCACACAGGGGG - Intronic
1074954751 10:118377605-118377627 TGCACTCTGGGGCACCCAGGTGG + Intergenic
1075277693 10:121109533-121109555 TCTGCTGTTGGGAGCACAGGGGG - Intergenic
1076259863 10:129056838-129056860 TGTGGTCATCGGCACACATGTGG + Intergenic
1076603003 10:131671127-131671149 TCTGCTGTTTGGCACACAGCTGG + Intergenic
1076863556 10:133155474-133155496 TGCGCTGGTGGGCACTCAGGTGG - Intergenic
1080196358 11:29614041-29614063 TGTGTTCATGGACAAACAGGAGG + Intergenic
1080526493 11:33126319-33126341 TGTGGTCTTGGCTACTCAGGAGG + Intronic
1081016276 11:37885500-37885522 TATGCTCTTGGGCAGATAGATGG + Intergenic
1081817295 11:45955046-45955068 AGTGCTCTGGGGCACAAATGCGG + Intronic
1081992929 11:47347334-47347356 TGTGCTCAGGGTCACACAGCTGG + Intronic
1083319586 11:61837712-61837734 TCTGCTCTTGGGCCCCAAGGAGG - Intronic
1083378218 11:62243546-62243568 TGCTCTGTTGGGGACACAGGTGG + Intronic
1083625528 11:64070163-64070185 TGTGCTCAGGGTCACACAGCTGG + Intronic
1085077490 11:73604611-73604633 TGAGCTCTGGGCCACAGAGGTGG - Intergenic
1085836556 11:79962967-79962989 TCTGCTCTTGGGAAGACTGGAGG - Intergenic
1087174837 11:95087255-95087277 TGTGCTCCTAGGGACAAAGGTGG - Intergenic
1089177298 11:116558056-116558078 TGTGCTCTTGCTCACAGTGGTGG - Intergenic
1089662490 11:119994489-119994511 TGGGCTCTTGGGCACATGGTGGG - Intergenic
1089849902 11:121487004-121487026 TGTGGGTTTGGGCACAAAGGGGG - Intronic
1095375096 12:41517629-41517651 TGTTCTGTGGAGCACACAGGTGG - Intronic
1095528532 12:43157327-43157349 AGTGTTCTGGGGCAGACAGGAGG + Intergenic
1096459816 12:51815807-51815829 TGTGCTGTGGGGCAGATAGGAGG - Intergenic
1096802545 12:54120689-54120711 TGTGCTGAGGGACACACAGGAGG - Intergenic
1099020435 12:77396893-77396915 TGTGTCCTTAAGCACACAGGAGG - Intergenic
1100507090 12:95232925-95232947 TGTGCTCTTAGCAACTCAGGAGG - Intronic
1101442852 12:104716347-104716369 GGTGCTCATGGTCACACAGCTGG - Intronic
1101866766 12:108526114-108526136 TTTGCTCTTATCCACACAGGGGG + Exonic
1101992049 12:109494177-109494199 TTTGCTCTTGGTCACACAGCAGG + Intronic
1102399558 12:112616643-112616665 TGTGCTCAGGGCCACACAGCAGG + Intronic
1102451709 12:113046834-113046856 CCTGGTGTTGGGCACACAGGAGG + Intergenic
1103997015 12:124836883-124836905 TGTGCTCTTGGGCAAGCGAGTGG - Intronic
1104230646 12:126880775-126880797 TGTGATTTGGGGCACAAAGGTGG - Intergenic
1105435990 13:20378837-20378859 TGTGCTGTGGGGCACGCAGTAGG + Intergenic
1105614391 13:21999193-21999215 TGTGCTCACCAGCACACAGGAGG + Intergenic
1105668913 13:22590560-22590582 TGTGTTCTTGGACACAGAGTGGG + Intergenic
1106055659 13:26234236-26234258 TGTGCTCTTCCGCATACAGGTGG - Intergenic
1109054602 13:57531722-57531744 TGTGCTCTTGGGCACTTAGAAGG - Intergenic
1110744893 13:79040446-79040468 TTGGCTCTTGGGCTCTCAGGAGG - Intergenic
1112291855 13:98150864-98150886 TTTGTTCTTTGGCACACAGAAGG + Intronic
1112921354 13:104616583-104616605 TATGCTGTTGGGCACACACAGGG + Intergenic
1119178033 14:72583884-72583906 TCTGCTCATGGGGACACAGGTGG + Intergenic
1120833874 14:89023018-89023040 TGTGCCCCTGTGCGCACAGGTGG + Intergenic
1122269077 14:100560343-100560365 GGTGCTGCTGGGGACACAGGAGG - Intronic
1122289484 14:100672513-100672535 GGTGCTCTTGTGCACACAGCAGG + Intergenic
1122579822 14:102764560-102764582 TGGGCCCTTGAGCACTCAGGAGG - Intergenic
1124260658 15:28187451-28187473 TGTGGTCTTAGGTACTCAGGAGG - Intronic
1124447607 15:29752048-29752070 TGTGATCCTGGGTACTCAGGAGG - Intronic
1125723708 15:41857368-41857390 CGAGCTCCTGGGCACACAGAGGG - Exonic
1126112069 15:45181179-45181201 AGTGCCCATGGGCACCCAGGTGG + Intronic
1128729970 15:70014459-70014481 TAAGCTCTTGGGCACACTGCTGG - Intergenic
1129359726 15:75017202-75017224 TGTTCCCTTTGGCACACAGTTGG - Intronic
1129516478 15:76160568-76160590 TGTGGTCTTGGGCCCACAGTTGG + Intronic
1129701596 15:77771632-77771654 AGTGCTCATGGGCACACCCGAGG + Intronic
1129764148 15:78150255-78150277 TTTGCTCAAGGTCACACAGGAGG + Intronic
1130041479 15:80408549-80408571 AGTGCTCTTGGGGACTCAGCAGG + Intronic
1130114662 15:80996338-80996360 TTTGCTTTTGTGCACACAGATGG - Intergenic
1131052479 15:89357982-89358004 TGTGCTCAAGGTCACACAGCTGG - Intergenic
1131525598 15:93150150-93150172 TGAGCTCCTTGGCACCCAGGAGG + Intergenic
1132208946 15:100006232-100006254 ACTCCTCTTGGCCACACAGGAGG + Intronic
1134880345 16:17740556-17740578 TGTGGTCTTGGCTACTCAGGAGG - Intergenic
1135144914 16:19953027-19953049 TGTGCTCTTGGGTACATAGAAGG + Intergenic
1137749043 16:50845160-50845182 TGTGCTCATGTGCAAACAAGTGG - Intergenic
1137897541 16:52230280-52230302 TCTTCTTTTGGGCACATAGGAGG - Intergenic
1138449485 16:57084841-57084863 GGTGATCTTGGGCACACTGAAGG - Intergenic
1141285340 16:82666756-82666778 TGTGCTCAAGGTCACACAGATGG + Intronic
1141689316 16:85587509-85587531 TGGGCTCCTGGGGACACAGCGGG + Intergenic
1142125208 16:88406734-88406756 TGTGCGCCTGGGCATAGAGGTGG + Intergenic
1142133109 16:88439853-88439875 TGTGCTCTTGGGGGACCAGGCGG - Exonic
1144207598 17:12990084-12990106 TGTGCTCCAGGGGACTCAGGCGG - Exonic
1146116988 17:30149711-30149733 TGTGGTCCTAGCCACACAGGAGG + Intronic
1146679570 17:34797364-34797386 TGAGGTCTGGGGCACACTGGAGG - Intergenic
1147749121 17:42717279-42717301 AATGCTGTTGGGCACACATGTGG - Intronic
1148197063 17:45721692-45721714 TGTGCCCTGTGGTACACAGGAGG - Intergenic
1148354792 17:46968627-46968649 CTTGCTCTTGCGCACACAGCTGG + Intronic
1149188568 17:54030921-54030943 TGTGATCTTAGGTACTCAGGAGG + Intergenic
1151905868 17:77048693-77048715 TGTGATCTTGGCTACTCAGGAGG + Intergenic
1153882572 18:9434099-9434121 TGTGCTCTTGGGGAGTGAGGAGG - Intergenic
1153945992 18:10017887-10017909 TGTGCAGCTGGGCACACAGAAGG - Intergenic
1156548302 18:37987865-37987887 TGTGCTCTTGGAAAGACAGGGGG - Intergenic
1156723720 18:40102183-40102205 TGTGATCCTGGCTACACAGGAGG - Intergenic
1157217108 18:45793399-45793421 TTTGCCCAAGGGCACACAGGTGG - Intergenic
1159908497 18:74120088-74120110 TGTGCACTAGGGCACACTGGGGG + Intronic
1160982802 19:1823913-1823935 TGAGCTGCTGGGCACACTGGGGG + Intronic
1162857967 19:13483614-13483636 TATGGTCTTGGGCAGACTGGAGG + Intronic
1163154018 19:15430306-15430328 TGTGCCCAAGGGCACACAGCAGG + Intronic
1164883801 19:31760200-31760222 TGTGCTCTTGAGCACCCACCAGG + Intergenic
1166137281 19:40785387-40785409 TGTGGTCTGGGGTACTCAGGAGG + Intronic
1167608550 19:50494774-50494796 TGAGGTGGTGGGCACACAGGAGG + Intergenic
925432576 2:3807872-3807894 TGAGCTGTTGTGCACACAGATGG - Intronic
926701440 2:15806802-15806824 TGTGCTCTTGAGCACAGAGGAGG + Intergenic
928913604 2:36447932-36447954 AGAGCTGCTGGGCACACAGGGGG - Intronic
929582088 2:43087869-43087891 TGTGCTCTTGGGAACCCAACAGG + Intergenic
933902583 2:86860701-86860723 TGTGCTCACGAGCACACAGTGGG + Intronic
935777963 2:106488567-106488589 TGTGCTCACGAGCACACAGTGGG - Intergenic
936161498 2:110087039-110087061 TGTGCTCAAGGGCAGCCAGGAGG - Intronic
936183165 2:110284315-110284337 TGTGCTCAAGGGCAGCCAGGAGG + Intergenic
936475273 2:112834080-112834102 TGTACTCAAGGGCACACAGCAGG + Intronic
943129266 2:183837333-183837355 TCTGCTCTTGGGGGCCCAGGAGG + Intergenic
945555832 2:211274783-211274805 TCTGCTTTTTGGCAAACAGGGGG - Intergenic
947461262 2:230306524-230306546 AGTGCTCTTGGGGGCCCAGGAGG + Intronic
948396197 2:237647228-237647250 TTCTCTCTTGGGCACACTGGAGG + Intronic
1168802349 20:651718-651740 TATGCAGGTGGGCACACAGGTGG + Intronic
1171497250 20:25564437-25564459 TGTGATCTTAGCTACACAGGAGG - Intronic
1171794200 20:29553897-29553919 TGTGCTGAGGGACACACAGGAGG + Intergenic
1171854271 20:30330494-30330516 TGTGCTGAGGGACACACAGGAGG - Intergenic
1172100496 20:32482246-32482268 TGTGCTCTTGGGGAGAGGGGAGG + Intronic
1172624970 20:36341701-36341723 TCTGCTCTAGTGCACACAGTAGG + Intronic
1173367892 20:42404124-42404146 TCTTCTCCTGGGCACACAGTTGG + Intronic
1173558095 20:43982314-43982336 TGTGCTGTGGGGCAGACAGGTGG + Intronic
1173923195 20:46761366-46761388 TCTGGTGTTGGGCACACAGCAGG - Intergenic
1174356054 20:49998633-49998655 CTTGCTCTAGGTCACACAGGAGG - Intergenic
1174571822 20:51507510-51507532 TGTGATCTTTGGCACAGAGAAGG - Intronic
1174615481 20:51832374-51832396 CGGCCTCTTGGGCACAGAGGAGG - Intergenic
1175533779 20:59693069-59693091 TCTGCTCAAGGTCACACAGGTGG - Intronic
1176049062 20:63107100-63107122 TGTGCTCTTGGACTCACTGGAGG - Intergenic
1176096146 20:63345438-63345460 TGTGCCCCTGGGGACACTGGGGG + Exonic
1176257377 20:64159403-64159425 TTTGCTCTTGGTCACCCAGCTGG + Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178353929 21:31894781-31894803 TTTGCTCTAGGGCACAGAGTTGG + Intronic
1179975494 21:44863390-44863412 TGTGCTCTTGGGCACACAGGAGG - Intronic
1180967949 22:19800293-19800315 TGGGGTCCTGGGCACAGAGGTGG + Intronic
1181395569 22:22618771-22618793 TGTGCTCATGGGCACTCTGAGGG + Intergenic
1181890105 22:26055071-26055093 TGTGGTGTCTGGCACACAGGAGG - Intergenic
1182011015 22:27000704-27000726 CTTGCTCATGGGCACATAGGTGG - Intergenic
1182566107 22:31201098-31201120 TGTTCCCTTGGGCACAGGGGTGG + Intronic
1183589164 22:38769917-38769939 TGTGTTATTGGGCCCACAGTGGG - Intronic
1183591959 22:38784384-38784406 CCTCCTCATGGGCACACAGGAGG + Intronic
1183978925 22:41528414-41528436 TGTGCCCTTGGCCCCGCAGGGGG - Exonic
1184436056 22:44477818-44477840 TGTGCTCTTGGGGACAAAAGTGG - Intergenic
1184695587 22:46137200-46137222 TGTGCCCTGGGGCTCACGGGAGG - Intergenic
1185312333 22:50163001-50163023 AGTGCTCTTGGGCAGAGACGTGG + Intergenic
1185341410 22:50292968-50292990 TGTGCTCGTGGGCACCTGGGGGG - Intronic
1185385160 22:50528570-50528592 CGTGGTCTGGGGCACACAGGAGG - Exonic
949339503 3:3013552-3013574 TGTTCACTTGGGCACCCTGGCGG - Intronic
949460394 3:4286003-4286025 TTTGCTCTGGGCCAAACAGGTGG - Intronic
950620050 3:14197799-14197821 TCTCCTCCTGGGCACACAGCTGG - Intronic
953032352 3:39187009-39187031 TGTGCTCTCGGGCACAGGGCAGG - Exonic
954665599 3:52249871-52249893 TTTGCTCTTGGTCACACTGGAGG - Exonic
954875668 3:53801512-53801534 TGTGCTCTGGGGCATGGAGGAGG + Intronic
955416802 3:58699800-58699822 TGGGCGTTTGGGGACACAGGTGG + Intergenic
962342425 3:134596703-134596725 TCTGCTCCTCGGCACACAGTAGG - Intergenic
962423887 3:135251959-135251981 TGTGCTCAAGGTCACACAGTAGG - Intronic
962532021 3:136291227-136291249 TGTAGTCTTGGGTACTCAGGAGG - Intronic
965940816 3:174179219-174179241 TGAGTTCTTGGCCACACAGCAGG + Intronic
969591939 4:8127108-8127130 TGTGCTCCTGTGCTCCCAGGGGG - Intronic
970650073 4:18167994-18168016 TCTGCTCTGGGGCACACTAGAGG - Intergenic
970743649 4:19268050-19268072 TCTTTTCTTGGGTACACAGGTGG - Intergenic
971152340 4:24046666-24046688 TCTTCTCCTGGGCACACAGCTGG + Intergenic
971893232 4:32553980-32554002 TGTGATCCTAGGCACTCAGGAGG - Intergenic
973303998 4:48623327-48623349 TGTGACCTTGGGCAAAGAGGAGG - Intronic
975111094 4:70627336-70627358 TGTTCTCTTGGCCACAAGGGTGG - Intergenic
975739135 4:77411665-77411687 TCAGCTTTTGTGCACACAGGTGG - Intronic
976220447 4:82753049-82753071 TGTGCTCCTGGGCAAACTGATGG - Intronic
976375209 4:84338578-84338600 TGTGCGCATGTGCACACTGGTGG + Intergenic
978737531 4:112100787-112100809 AGTTCTCTTGGGCACAATGGGGG + Intergenic
980852961 4:138405595-138405617 TGTGGTCTTTGTCACACTGGTGG - Intergenic
982883306 4:160746892-160746914 TATGCTCTTGCCCACAGAGGTGG - Intergenic
988169952 5:27640565-27640587 AGGGCTCTTGGCCACAGAGGTGG + Intergenic
990551992 5:56890922-56890944 TGTGCTCCAGGGTACTCAGGAGG + Intronic
991521516 5:67503333-67503355 TGTCCTTTTGGGCACTCAGTTGG - Intergenic
993034008 5:82737090-82737112 TGTGCTCATGTGCAGACATGCGG - Intergenic
994709883 5:103254579-103254601 TGTCCTCCTCCGCACACAGGAGG + Intergenic
995853218 5:116568680-116568702 TGTGCTCTTGGACACAGGAGGGG + Intronic
997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG + Intronic
1000907937 5:166986056-166986078 TGTGCTTTTGGGGACAAAGATGG + Intergenic
1001175669 5:169466644-169466666 TTTCCTCTTGGGTACACAGCTGG - Intergenic
1003760182 6:9171212-9171234 TGTGCTCCTGGGAGAACAGGGGG + Intergenic
1006594263 6:35181584-35181606 TGAGCTCTGGGCCACTCAGGAGG - Intergenic
1006902435 6:37511868-37511890 TGGGCTTCTTGGCACACAGGAGG - Intergenic
1010336523 6:74690989-74691011 TGTGGTCTTAGCTACACAGGAGG - Intergenic
1010649387 6:78433715-78433737 TGTGGTCTTGTGCTCACATGTGG + Intergenic
1011806838 6:91081606-91081628 TGTGCTCTTGCACAAACAGAAGG + Intergenic
1012265635 6:97138415-97138437 TGTGGTCCTGGCCACTCAGGAGG + Intronic
1012501623 6:99894938-99894960 TCTTCTCTTGGCCACAAAGGTGG + Intergenic
1015614517 6:135061102-135061124 TGTGCTTTAAGGCACACAGGAGG - Intronic
1016838037 6:148498760-148498782 TGTGCTCTTGGGAACAACGCTGG + Intronic
1017615786 6:156245007-156245029 TGCGGTCTTGGTAACACAGGCGG + Intergenic
1017977802 6:159373592-159373614 TGTGCTCCTGGGACCAGAGGTGG - Intergenic
1019672348 7:2287983-2288005 TGTGCTTTTGAACACACTGGTGG + Intronic
1019723902 7:2590125-2590147 TGTGCCCGTGGGGACACTGGCGG - Intronic
1019784026 7:2962097-2962119 TGTAGTCTTGGCTACACAGGAGG + Intronic
1020305582 7:6831573-6831595 TGTGATCTTAGCCACTCAGGAGG - Intergenic
1020685285 7:11286158-11286180 TGTGTTCTGTGGCACACATGAGG + Intergenic
1020879972 7:13749180-13749202 AGAGCTCTGGGGCCCACAGGGGG - Intergenic
1021354952 7:19642742-19642764 TGTGGTCTTGGGTACAGTGGTGG - Intergenic
1021984801 7:26088085-26088107 TGTGCTCAAGGCCACACAGATGG + Intergenic
1022368664 7:29750193-29750215 GGGGCTCATAGGCACACAGGAGG - Intergenic
1024574427 7:50752655-50752677 TGGGCTCTTACTCACACAGGAGG - Intronic
1024929049 7:54650578-54650600 TCTGCTCCTGGGGACACAAGAGG + Intergenic
1025046393 7:55695624-55695646 TGTGGCCTTGGACACACGGGTGG + Intergenic
1025634450 7:63309476-63309498 TGTGCTCTTGGCCACCTAGAAGG + Intergenic
1025648248 7:63438699-63438721 TGTGCTCTTGGCCACCTAGAAGG - Intergenic
1026609343 7:71843757-71843779 TATGCTCATGGGCACGCATGAGG + Intronic
1026656905 7:72264620-72264642 TGTGGTCTTGGATACTCAGGAGG - Intronic
1027842129 7:83326270-83326292 TATGCTCTTGGGACCACTGGAGG - Intergenic
1028900723 7:96097622-96097644 TGAGCTCTAGGACACAAAGGTGG - Exonic
1029117415 7:98244470-98244492 TGTCCCCTGGTGCACACAGGTGG + Intronic
1031522891 7:122788010-122788032 TGTGCTCTTATTCTCACAGGGGG - Intronic
1033600364 7:142884685-142884707 TGTGCTCTTCCGCATTCAGGTGG - Intronic
1034218512 7:149426389-149426411 GGTGTTCCTGGGCACACTGGTGG - Intergenic
1034500938 7:151450366-151450388 TGTGGTGGTAGGCACACAGGTGG + Intergenic
1039395550 8:37222395-37222417 TGAGTTCCTGGGCCCACAGGGGG - Intergenic
1039413177 8:37372697-37372719 TCTGCTCAAGGCCACACAGGTGG - Intergenic
1042183066 8:66111398-66111420 TCTGCTCTAGTGCACACAGTTGG - Intergenic
1044345807 8:91103055-91103077 TGTGCTCTTTGGCCCACATCTGG + Intronic
1047146320 8:122203233-122203255 TGTGGTCTTAGGTACTCAGGAGG + Intergenic
1048440286 8:134454592-134454614 TGAGCTCTTTGTCACTCAGGGGG + Intergenic
1048968783 8:139632499-139632521 CCTGCTCCTGGGCACACAGCTGG + Intronic
1049650743 8:143767761-143767783 TGTGGTCTTGGCTACTCAGGAGG + Intergenic
1049801489 8:144519737-144519759 TGTGTTCTTGAGCACACGGCAGG + Exonic
1050182240 9:2934049-2934071 TGCGCTCTTGGGGGCCCAGGAGG + Intergenic
1053276539 9:36787667-36787689 TGTGCACTTGCGCTCACATGTGG + Intergenic
1053290884 9:36879090-36879112 TCTGTCCTTGGGCACAGAGGAGG - Intronic
1053417874 9:37958191-37958213 TGTGTACACGGGCACACAGGAGG + Intronic
1054153079 9:61620992-61621014 TGTGCTGAGGGACACACAGGAGG + Intergenic
1058088401 9:100776479-100776501 TGTGGTATTGGGCACACAGATGG + Intergenic
1058642604 9:107101951-107101973 ACTGCTATTGGGCTCACAGGTGG - Intergenic
1059055374 9:110973555-110973577 TGTTCTCTTTCTCACACAGGTGG - Exonic
1060545314 9:124455923-124455945 TGTCCTCTGAGGCCCACAGGGGG - Intronic
1060790708 9:126483699-126483721 TGTGGTCTGTGGCACCCAGGGGG - Intronic
1061488833 9:130934164-130934186 TGGGCTCCTGGGGAGACAGGAGG - Intronic
1061748592 9:132758142-132758164 TGAGCTCTTGGGCACTTTGGTGG + Intronic
1062284111 9:135765515-135765537 TGAGCTCTAGGGCCCAGAGGTGG + Intronic
1187947032 X:24436049-24436071 TGTGGTCTTGGCTACTCAGGAGG - Intergenic
1188996811 X:36896859-36896881 AGTGCTCAGGGGCCCACAGGTGG - Intergenic
1192888627 X:75364040-75364062 TATGCTCTTGGCCACCCAGAAGG + Intergenic
1193468828 X:81875843-81875865 TGTGCTCTTGGGAGCCCAGAAGG - Intergenic
1195366064 X:104126530-104126552 TGTGGTCCTGGGTACTCAGGAGG + Intronic
1196468216 X:115994005-115994027 TGTGCTTATGGTCACACTGGTGG - Intergenic
1197261805 X:124327855-124327877 TGTGCCCTTGGGCAGAGAGCAGG + Intronic
1197566059 X:128088342-128088364 TGGGGTCTGGGGCACACATGGGG - Intergenic
1198087239 X:133293040-133293062 TGTGATCTAGGGTACACAAGTGG + Intergenic
1198717887 X:139581092-139581114 TGTGGTCTCTGGCACACAGTAGG + Intergenic
1202109395 Y:21405368-21405390 TGTGCCCCTGGGCACACGGGAGG + Intergenic