ID: 1179975571

View in Genome Browser
Species Human (GRCh38)
Location 21:44863956-44863978
Sequence GCCTCCTCAAACCTACGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179975567_1179975571 12 Left 1179975567 21:44863921-44863943 CCTTAGAATAGAAATCATCGAAT 0: 2
1: 0
2: 0
3: 10
4: 146
Right 1179975571 21:44863956-44863978 GCCTCCTCAAACCTACGCTACGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179975571 Original CRISPR GCCTCCTCAAACCTACGCTA CGG Intronic
908488664 1:64620897-64620919 TCCTCCTCCAACCAACTCTAAGG - Intronic
910734282 1:90435038-90435060 GCCTCCTTAAAGCTACCCTAAGG - Intergenic
914260900 1:145998349-145998371 GCCGCCTCAAACACACCCTAAGG - Intergenic
1062940343 10:1416419-1416441 TCCTCCTCTAACCTACTCTGGGG + Intronic
1064726206 10:18282254-18282276 GCTACCTCAAACCTAAGCCATGG - Intronic
1065427432 10:25619839-25619861 GCCTACTCAAACCTCAGCAATGG - Intergenic
1074469804 10:113716387-113716409 GCTTCCTCAAAGTTAAGCTATGG + Intronic
1078943977 11:16043085-16043107 GTCTCCTCAGAGCTAAGCTAAGG - Intronic
1085392474 11:76189505-76189527 GCCTCCTCAAATCTAACCTGGGG - Intronic
1089070615 11:115696817-115696839 GCCTCCTCAAACCCTGGCTGAGG - Intergenic
1096955871 12:55525562-55525584 GCCTCCTCAATCTTACGACATGG + Intergenic
1101081394 12:101188988-101189010 GCCTTCTCACACTTACGCTATGG - Intronic
1114744993 14:25137049-25137071 GCCTACTCAAACCTCAGCAATGG - Intergenic
1120010022 14:79403263-79403285 GCCTCCTTAATCCTATGCTAGGG + Intronic
1121116047 14:91343500-91343522 GCATCCTCCCACCTAAGCTAAGG + Intronic
1133062082 16:3181667-3181689 GCCTCCTCACATCTACTCTGAGG - Intergenic
1133284210 16:4683083-4683105 GCCTCCACAGACCGAGGCTAAGG - Intronic
1139400504 16:66677572-66677594 GCCACCTCATACCAACCCTATGG + Intronic
1149222895 17:54436176-54436198 GCCTACTCAAACCTCAGCGATGG - Intergenic
1154072332 18:11163913-11163935 GACGCCTCAAACCTGCGTTAGGG - Intergenic
1160662081 19:305973-305995 GTCTCCTCAAACCCACGCCTGGG + Exonic
1164152364 19:22566134-22566156 GCCTACTCAAACCTCAGCAATGG + Intergenic
927211277 2:20640595-20640617 GCCTCCTCCAACCAGCCCTAGGG - Intronic
947818144 2:233051818-233051840 GCCTCCTCCAACCTCCGTTCTGG - Intergenic
1169669652 20:8082205-8082227 GCCAGCTCAAACCTCCACTAGGG - Intergenic
1178916835 21:36709497-36709519 GCCACCTGAGACCTACGCCAGGG + Intronic
1179379036 21:40881359-40881381 ACCTCCTCTAACCCAGGCTATGG + Intergenic
1179975571 21:44863956-44863978 GCCTCCTCAAACCTACGCTACGG + Intronic
955006512 3:54973663-54973685 TCGTCCTCAAACCTACCCTCTGG - Intronic
958166249 3:89881429-89881451 GCCTACTCAAGCCTAGGCAATGG - Intergenic
970566976 4:17341006-17341028 CCCTCCCCAACCCTACACTATGG + Intergenic
973690445 4:53423361-53423383 GCCTAATCAAACCTACGCTTTGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
988696214 5:33624963-33624985 GCCACCTCAAATCTACTCAAAGG + Intronic
1001315989 5:170641635-170641657 GCCTCCCCCAACCAAGGCTAGGG - Intronic
1002115175 5:176955864-176955886 GACTCTTCAAACCTACTCTCTGG - Intronic
1005850204 6:29815111-29815133 GCCTGCTTAAACCTATACTAAGG - Intergenic
1009885452 6:69618772-69618794 GCCTGCTTAAACCTACACTAAGG + Intergenic
1011251613 6:85377648-85377670 GCCTACTCAAACCTCAGCAATGG - Intergenic
1014013309 6:116501304-116501326 GCCTACTCAAACCTCAGCAATGG - Intronic
1024345632 7:48310495-48310517 GCCTCCTCAAACATGCTCCAGGG - Intronic
1033304257 7:140212846-140212868 GCCTTCTCACACCTGGGCTAGGG + Intergenic
1034338495 7:150338271-150338293 GCCGCCTCTGAGCTACGCTAAGG + Intergenic
1034474603 7:151275277-151275299 GCCTCCTTGAATCTACGCTGGGG - Intronic
1039902860 8:41765931-41765953 GCCTCCTCACACCTTCTCTGGGG + Intronic
1043669631 8:82865879-82865901 GCATCCTCAAACCTTAGGTAAGG - Intergenic
1048252095 8:132875098-132875120 GCCTCATCAAATCTTCACTATGG - Intronic
1050215000 9:3312828-3312850 ACCTACTCAAACCTAAGCAATGG - Intronic
1051701945 9:19833540-19833562 ACCTCCTCAAGCCTGCGCAATGG - Intergenic
1056297454 9:85207032-85207054 GCCTGATCAAACCTGCTCTATGG + Intergenic
1060994562 9:127868677-127868699 CCCTGCTCAAACCTACACCATGG + Intronic
1191197909 X:57744457-57744479 GCCTACTCAAGCCTAAGCAATGG - Intergenic
1198663489 X:138996514-138996536 GCCTACTCAAGCCTAAGCAATGG - Intronic