ID: 1179976840

View in Genome Browser
Species Human (GRCh38)
Location 21:44873305-44873327
Sequence GCGGGAGCTGCCGTCGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179976840_1179976849 5 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976849 21:44873333-44873355 CCAAACGGGCGTGACCCTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
1179976840_1179976853 19 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976853 21:44873347-44873369 CCCTCGAGGAGCCTCCGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1179976840_1179976851 18 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976851 21:44873346-44873368 ACCCTCGAGGAGCCTCCGTCGGG 0: 1
1: 0
2: 2
3: 4
4: 63
1179976840_1179976844 -9 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976840_1179976850 17 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976840_1179976843 -10 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976843 21:44873318-44873340 CAGCTCCCGCGGCCGCCAAACGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179976840 Original CRISPR GCGGGAGCTGCCGTCGCGGC TGG (reversed) Intronic
900414697 1:2529581-2529603 GCGGGCGCGGCGGGCGCGGCCGG + Exonic
900416022 1:2535012-2535034 GCGGGAGCTGCAGTGGGGGAGGG + Intergenic
900985681 1:6071804-6071826 GCAGGAGGTGCCCTCGCGGCAGG - Intronic
900985691 1:6071841-6071863 GCAGGAGGTGCCCTCGCGGCAGG - Intronic
901556094 1:10032734-10032756 GCTGGGGCTGCGGGCGCGGCGGG - Intergenic
901813348 1:11779913-11779935 GCGGCTGCTGCAGTCACGGCTGG + Exonic
903813176 1:26046058-26046080 GCCGGAGCTGCAGCCGCAGCGGG - Exonic
905390808 1:37634478-37634500 GCGGGCCCTCCCGTCGGGGCTGG - Intronic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
923035196 1:230280694-230280716 GAGGGAGCTGCGGGCGGGGCAGG - Exonic
924482612 1:244451210-244451232 GGGGGTTCTGCCGTCGCGCCGGG + Intronic
1064443146 10:15371189-15371211 GAGGGAGCGGCCGGGGCGGCGGG - Intergenic
1067910686 10:50343818-50343840 GCTGAAGCTGCCGTCGGGGGTGG + Exonic
1069698295 10:70404081-70404103 GCCGGAGGTGACGTCGCCGCGGG - Intergenic
1072745248 10:97934969-97934991 GGGGGAGCGGCGGGCGCGGCGGG + Intronic
1074088395 10:110226028-110226050 GCGGGCGCGGCTGGCGCGGCTGG + Intronic
1074772371 10:116742394-116742416 GCGGGTCCTGCGGCCGCGGCTGG - Intronic
1074865365 10:117541860-117541882 CCGGGAGCTGCCGACCCCGCCGG - Intergenic
1076858583 10:133129153-133129175 GCGGGGGCTGCCATCCAGGCTGG - Exonic
1077046030 11:545553-545575 CCGGGAGCTGCCGTCTGGTCCGG - Intronic
1077285635 11:1764080-1764102 GCGGGAACTGTAGGCGCGGCAGG - Intergenic
1080012420 11:27472314-27472336 GCGGGAGAGGCCGGCGCGGGAGG - Exonic
1081763861 11:45595619-45595641 GAGGGAGCTGCCATCACAGCAGG + Intergenic
1083271442 11:61574859-61574881 CCGGGAGCAGCTGCCGCGGCAGG + Intronic
1083912636 11:65719239-65719261 GTGGGAGCTGCAGTGGGGGCGGG - Exonic
1084172411 11:67406862-67406884 GCGGAAGCAGCCGCCGCAGCAGG - Exonic
1085208066 11:74749048-74749070 GCCGCCGCTGCCGCCGCGGCCGG + Exonic
1090780380 11:130002191-130002213 GCGGGCGCTCCGGGCGCGGCGGG - Intronic
1091586584 12:1820380-1820402 GTGAGCGCTGCCCTCGCGGCCGG + Exonic
1095261740 12:40105935-40105957 GCGGCTGCTGCCGTGGCAGCCGG - Intronic
1096241394 12:49961977-49961999 GCGGCAGCTGCCGCGGCGGGGGG - Exonic
1097190409 12:57216842-57216864 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1097190412 12:57216851-57216873 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1099439892 12:82687024-82687046 GCAGCAGCTGCCTTGGCGGCCGG + Exonic
1100260512 12:92928859-92928881 GCGGGTGGGGCCGGCGCGGCGGG - Intronic
1101957958 12:109227412-109227434 CCGGGAGCTGCCGGTGCTGCAGG - Exonic
1103534760 12:121626825-121626847 GCCGGAGCCGCCGCCGCAGCGGG + Exonic
1105250926 13:18697999-18698021 GCAGGGGCTGCCGTGGGGGCTGG + Intergenic
1107851784 13:44577900-44577922 GCGGCAGCAGCCGCGGCGGCGGG - Intergenic
1114312214 14:21477569-21477591 GCCAGAGCTGCCGACGCCGCGGG + Intronic
1115119938 14:29927448-29927470 GCGGCAGCTGCCGCCGCCACGGG + Exonic
1117315158 14:54566193-54566215 GCGGGCCATGCCGTCGGGGCGGG - Intergenic
1117690197 14:58298593-58298615 GCAGGAACTGCAGCCGCGGCTGG + Exonic
1117966087 14:61207896-61207918 GCTGGAGCTGCCTTCGCTGCCGG - Intronic
1119438144 14:74611452-74611474 CCGTGAGCCGCCCTCGCGGCGGG + Exonic
1121279346 14:92687967-92687989 GCGGACGCTGGCGTCGCGGGCGG + Exonic
1122746034 14:103897728-103897750 GCGCGAGCTGCCCTCGGGCCTGG - Intergenic
1123001999 14:105300803-105300825 GCGGGCGCGGCCGTTGCGGGCGG - Exonic
1125509029 15:40282999-40283021 GCGGGCGCCACCGTCGCTGCGGG - Intronic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1127982711 15:64046350-64046372 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982714 15:64046359-64046381 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982717 15:64046368-64046390 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1129853790 15:78810636-78810658 GCGGGAGCTGGGGGGGCGGCGGG + Intronic
1130531122 15:84748516-84748538 GCGGGAGCCGGCCTGGCGGCGGG - Intergenic
1131260370 15:90884575-90884597 GTGGGAGCTGGGGGCGCGGCAGG + Intronic
1132375630 15:101326627-101326649 GCGGGAGCAGCCGTCCCTGCGGG + Intronic
1132581124 16:685072-685094 GAGGCAGCTGACGGCGCGGCTGG + Exonic
1132583407 16:695306-695328 GCGGGGGCTTCCGGCGGGGCTGG - Intronic
1132757678 16:1493855-1493877 GCGGGAGCTGCCGGCCCTCCCGG - Intronic
1132915350 16:2340819-2340841 GCCGGAGCGGCCGAGGCGGCCGG - Intergenic
1132934585 16:2474224-2474246 GAGGGAGCTGCCGGCGGGGACGG - Intergenic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1135206777 16:20491692-20491714 GCGGGAGCAGCCGTGGCAGCAGG + Intergenic
1135212108 16:20531940-20531962 GCGGGAGCAGCCGTGGCAGCAGG - Intergenic
1135424554 16:22325840-22325862 GCGGGAGCTGCAGCGGCGGAAGG + Exonic
1136509149 16:30725034-30725056 GGGGGGGCTGGCGTCGAGGCCGG - Exonic
1138179223 16:54931003-54931025 GCGGGCGCGGCGGTCGCAGCCGG + Exonic
1142419722 16:89962933-89962955 ACGGGAGCTGCAGTCCTGGCAGG + Intronic
1142591517 17:1008191-1008213 GCAGGAGCTGCCATCAGGGCTGG + Intronic
1142764410 17:2057416-2057438 GCGCGAGCTGCCCCCGCGCCCGG + Exonic
1142764665 17:2058479-2058501 GGGGGCGCGGCCGGCGCGGCCGG + Exonic
1143697424 17:8630688-8630710 GCTGGATCTGTGGTCGCGGCTGG - Exonic
1144784379 17:17823693-17823715 GCGGGACCTGCAGGCGGGGCGGG - Intronic
1145750017 17:27349086-27349108 GCTGGAGCAGCAGTGGCGGCGGG + Intergenic
1146283317 17:31559109-31559131 GCTGGAGCGGGCGTCGCGGCCGG + Intergenic
1147486357 17:40818873-40818895 GCCGGAGCTGCTGCCGCCGCCGG + Exonic
1147699957 17:42387851-42387873 GCGGGAGCCGCCGACCGGGCGGG + Intronic
1152605121 17:81285726-81285748 GCTGGGGCTGCCGACGGGGCTGG - Intronic
1152896569 17:82914657-82914679 CCGGGAGCTGAGGTCACGGCTGG - Intronic
1154326567 18:13395568-13395590 GCGGGAGCTGGCGTGGGGGCGGG + Intronic
1154326574 18:13395586-13395608 GCGGGAGTTGGCGTGGGGGCGGG + Intronic
1154326581 18:13395604-13395626 GCGGGAGTTGGCGTGGGGGCGGG + Intronic
1154326600 18:13395658-13395680 GCAGGAGCTGGCGTGGGGGCGGG + Intronic
1154437919 18:14360915-14360937 GCAGGGGCTGCCGTGGGGGCTGG - Intergenic
1157279092 18:46334161-46334183 GCGGGAGCCGCCGGGGCGGGAGG - Intronic
1160499755 18:79395852-79395874 GCGGGAGCCGCCGGGCCGGCGGG + Intronic
1160699158 19:497811-497833 GCGAGAGCCGCGGTCGCCGCAGG + Exonic
1160704336 19:522948-522970 GCAGGAGCTGCCGTCAGCGCAGG - Intergenic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161314873 19:3613079-3613101 GCGAGAGCTGCAGGCGCTGCAGG + Exonic
1161560292 19:4969274-4969296 GCGGGGGCGGCCATGGCGGCGGG - Intronic
1162744821 19:12792363-12792385 GCCGGGGCTGCCGTCGGGACCGG + Exonic
1163369506 19:16894083-16894105 GTGGGAGCTGCCGTGGCCCCAGG + Intronic
1163398088 19:17075762-17075784 GGGGGAGCGGCGGGCGCGGCGGG + Exonic
1163557627 19:18001545-18001567 GCAGCAGCTGCCGACGCCGCAGG - Intronic
1163607142 19:18281578-18281600 CCGGGCGCTGCGGCCGCGGCCGG - Exonic
1163702031 19:18790849-18790871 GCGGGAGCTGCTGCGGCAGCAGG - Exonic
1165750422 19:38256189-38256211 GCGGGAGCTGCAGCGGCGGCTGG - Exonic
1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG + Intronic
1166524334 19:43501772-43501794 GCGGGAGCTGCTGGAGCAGCAGG - Exonic
1166529729 19:43535102-43535124 GCGGGGGCCGCCGGCGAGGCCGG - Exonic
1166732005 19:45064453-45064475 CCGGGAGCGGGCGTGGCGGCCGG - Exonic
1166894402 19:46015073-46015095 GCGGGAGCTGGAGGCGCAGCTGG + Exonic
1168287587 19:55342227-55342249 GCAGGTGCTGCTGTCGCCGCAGG - Exonic
1168297937 19:55386776-55386798 GCGGTAACTGCCATCGCGGCGGG + Intronic
925609631 2:5692495-5692517 GTGGGAGCTGCGGTCGCGACAGG - Intergenic
925984882 2:9207276-9207298 GCGGGAGCGGCGGGCGGGGCTGG - Intronic
926432798 2:12806682-12806704 GTGGGAGCTGACCTCGCAGCTGG - Intergenic
926914377 2:17878611-17878633 CCGGGAGCTGCGGGCGGGGCGGG - Intronic
929252893 2:39779125-39779147 GCGAGAGGTGCGGGCGCGGCTGG - Exonic
937993050 2:127674850-127674872 GCGGCAGCGCCCGTCGGGGCAGG - Intronic
944582118 2:201140136-201140158 GCGGGGGCTGCGGCAGCGGCGGG + Intronic
947122938 2:226836162-226836184 GCGGGAGCTGGCGGCCGGGCTGG + Intronic
947713736 2:232329888-232329910 GCGGGGGGTGCCGGCGCAGCAGG - Exonic
948460746 2:238128856-238128878 GCGGAAGCTGCAGGCGCGCCTGG + Exonic
948479123 2:238239517-238239539 GCTGGAGCTGACGGTGCGGCGGG - Exonic
1171227138 20:23451274-23451296 GCTGGAGCTGCCTTCGGGGGTGG + Intronic
1172484906 20:35292208-35292230 GCTGAAGCTGCCGTGGTGGCGGG - Exonic
1173516193 20:43667106-43667128 GCAGGAACTGCAGTCGCCGCCGG - Intronic
1174438230 20:50527188-50527210 GCTGGAGGGGCCGTCTCGGCTGG - Intronic
1176157014 20:63627003-63627025 TCGGGAGCTGCGGCGGCGGCGGG + Intronic
1176237970 20:64063098-64063120 GCGGGCGCGGCGGGCGCGGCAGG + Intronic
1179840548 21:44070112-44070134 GCGGGAGCTGCCTTCACGGGAGG + Intronic
1179906109 21:44424169-44424191 GCAGGGGCTGCCGTGGCCGCAGG - Intronic
1179976840 21:44873305-44873327 GCGGGAGCTGCCGTCGCGGCTGG - Intronic
1179996628 21:44977299-44977321 GCAGGGGCTGCCGTGGGGGCTGG + Intergenic
1180559011 22:16601269-16601291 GCCGGAGCCGAAGTCGCGGCTGG + Intergenic
1183368588 22:37419906-37419928 GCGGGGGCTGGCGGCGGGGCGGG - Intronic
1184207654 22:43015154-43015176 GGGGGCGGTGCGGTCGCGGCTGG - Intergenic
1184278605 22:43424954-43424976 GTGGGAGATGCCGGGGCGGCCGG + Exonic
950074547 3:10177914-10177936 GCGGGAGCTGCTGTGGTGGTGGG + Exonic
958942977 3:100335034-100335056 GCGGCGGGTGCCGGCGCGGCCGG - Intronic
964801767 3:160565472-160565494 GCCGGAGCTGCAGTCGCGCTGGG - Exonic
967880806 3:194299894-194299916 GCGGGAGCCGCCCGCCCGGCCGG + Intergenic
969115001 4:4865931-4865953 GCGGTAGCTGCAGGCGAGGCGGG + Intergenic
969278104 4:6150553-6150575 GTGGGAGCTGCCTCCGAGGCAGG - Intronic
969344728 4:6563625-6563647 GCGGGCGCGGCGGGCGCGGCGGG + Intergenic
970195080 4:13544426-13544448 GCAGGAGCGGCCGGCGGGGCGGG + Exonic
972640837 4:40923611-40923633 GCGGCTGCTGCCACCGCGGCTGG + Intronic
975779093 4:77820043-77820065 GCTGGGGCTGCCGCCGCTGCGGG + Intergenic
980130508 4:128812106-128812128 GCGGGAGGAGCTGCCGCGGCGGG + Intronic
980857303 4:138455104-138455126 GCTGGAGCTGCCATCACTGCTGG - Intergenic
984462904 4:180058775-180058797 GCTGGAGCGACCGCCGCGGCCGG + Intergenic
985779813 5:1864545-1864567 GAGGGAGCTGTCGCCGTGGCTGG - Intergenic
985857658 5:2442801-2442823 GCTGGAGGTCCCGTCGCAGCTGG - Intergenic
985950647 5:3219377-3219399 GCGGGAGCTGCTTCCACGGCAGG + Intergenic
985995648 5:3595724-3595746 GCGGGAGCGGCCGGCGAGGGCGG + Intergenic
990376247 5:55173428-55173450 CCGGGGGCTGCCACCGCGGCAGG + Intergenic
996765219 5:127029686-127029708 GCGGGAGCTGCTGTCGGTTCTGG - Intronic
1002211122 5:177600051-177600073 CCGGGAGCTGGCGGCGCGGCCGG + Intergenic
1005470264 6:26156406-26156428 GCCGGAGCAGCGGGCGCGGCAGG - Exonic
1005722476 6:28616577-28616599 GCGGGAACTGACGTCGGGGTAGG + Intergenic
1006134622 6:31888095-31888117 GCAGGAGCTGCAGTGCCGGCCGG + Exonic
1006321247 6:33320844-33320866 GCTGGAGCTGCTGTCGGGGGAGG + Exonic
1006472774 6:34237658-34237680 GCGGGAGCGGCCGCCGCGCGAGG - Intronic
1007584159 6:42978721-42978743 GCGGGTGCTGGAGACGCGGCCGG - Exonic
1013207590 6:107958464-107958486 GCCGGAGCAGCGGTCGCGGGCGG + Intergenic
1015024882 6:128520550-128520572 TGGAGAGCTGCCGCCGCGGCCGG - Exonic
1018929666 6:168232696-168232718 CCCGGAGCTGCCTTTGCGGCTGG - Intergenic
1019343756 7:519998-520020 CCGGGCGCCGCCGCCGCGGCAGG + Intronic
1019352599 7:562011-562033 GTGGGTGCTCCCGGCGCGGCCGG + Intronic
1020011855 7:4809552-4809574 GCGGGACCTGCCGTGGTGCCTGG - Intronic
1020162280 7:5781656-5781678 GCGCGAGGTGACGCCGCGGCAGG - Exonic
1022723027 7:32957597-32957619 GCAGGAGCAGCGGTGGCGGCGGG - Exonic
1024521076 7:50304502-50304524 GCGGGGGCGGCCGGCGCGGAGGG + Intronic
1027202336 7:76071960-76071982 CCGGGAGACGCCGTCGGGGCGGG + Intergenic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029168915 7:98617380-98617402 GCGGGAGGCGCCTTCGCTGCTGG - Exonic
1029560541 7:101300051-101300073 GCAGGAGCTGCCCTCGGGGCTGG - Intergenic
1029561952 7:101308747-101308769 GCAGGAGCTGCCCTCGGGGCTGG - Intergenic
1032020725 7:128406000-128406022 GCGGGGGCTGCGGCAGCGGCAGG + Intronic
1032077315 7:128842268-128842290 GCGGAAGGTGCCGTCGCCGTTGG - Exonic
1033306715 7:140230764-140230786 GCGGGACCAGCAGCCGCGGCAGG - Intergenic
1034618309 7:152436739-152436761 GCCGGAGCCGGAGTCGCGGCTGG - Intergenic
1035728987 8:1841854-1841876 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729008 8:1841908-1841930 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729055 8:1842034-1842056 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1039921425 8:41896688-41896710 GATGGCGCTGCCGCCGCGGCCGG + Exonic
1042837725 8:73092972-73092994 CCGGGCGCTGCTGTCCCGGCCGG - Exonic
1042837774 8:73093142-73093164 CCGGGAGCTGCCCGAGCGGCCGG + Exonic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1049452514 8:142669816-142669838 GCGGGAGCCGCAGTCTGGGCAGG - Intronic
1049496782 8:142939293-142939315 GCGGGGTCTGCAGTCGGGGCAGG + Intergenic
1052358311 9:27528587-27528609 GCCGGAGCTGGCGTGGGGGCCGG + Intronic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1057490369 9:95515931-95515953 GCGGGAGCAGCCGCAGCCGCAGG - Intronic
1060147897 9:121268085-121268107 GCGGGAGCCGCCCTCGGGGCGGG - Intronic
1060945825 9:127568984-127569006 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1061450195 9:130663551-130663573 GCCGCAGCGGCCGTCGGGGCTGG - Intergenic
1061875322 9:133540676-133540698 GCAGGATGTGCCGTCGCGGGCGG - Exonic
1062277183 9:135736607-135736629 GCGGGAGCGCTCGGCGCGGCGGG - Intronic
1062332239 9:136049887-136049909 GCGGGGGCTGCGGTGGCGGCGGG - Exonic
1203793234 EBV:162689-162711 GCTGGAGCGGCTGTCTCGGCTGG - Intergenic
1187394286 X:18906464-18906486 GCGGGAGCTGCAGGAGCTGCGGG + Intronic
1193655005 X:84188030-84188052 GCGAGCGCTGCCCTCGCCGCCGG + Intergenic
1198480219 X:137033916-137033938 GCGGGCGCTGCGGGCGCGGCAGG + Intergenic
1198636997 X:138711734-138711756 GAGGGAGGGGCCGTCGCGGGAGG - Intronic
1200066268 X:153505478-153505500 CCGGGAGCTCCCATCACGGCTGG - Intronic