ID: 1179976840

View in Genome Browser
Species Human (GRCh38)
Location 21:44873305-44873327
Sequence GCGGGAGCTGCCGTCGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179976840_1179976843 -10 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976843 21:44873318-44873340 CAGCTCCCGCGGCCGCCAAACGG 0: 1
1: 0
2: 0
3: 3
4: 80
1179976840_1179976844 -9 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976840_1179976853 19 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976853 21:44873347-44873369 CCCTCGAGGAGCCTCCGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1179976840_1179976850 17 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976840_1179976849 5 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976849 21:44873333-44873355 CCAAACGGGCGTGACCCTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
1179976840_1179976851 18 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976851 21:44873346-44873368 ACCCTCGAGGAGCCTCCGTCGGG 0: 1
1: 0
2: 2
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179976840 Original CRISPR GCGGGAGCTGCCGTCGCGGC TGG (reversed) Intronic