ID: 1179976844

View in Genome Browser
Species Human (GRCh38)
Location 21:44873319-44873341
Sequence AGCTCCCGCGGCCGCCAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179976833_1179976844 4 Left 1179976833 21:44873292-44873314 CCCTGCCCGCGCCCCAGCCGCGA 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976837_1179976844 -2 Left 1179976837 21:44873298-44873320 CCGCGCCCCAGCCGCGACGGCAG 0: 1
1: 0
2: 0
3: 8
4: 198
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976834_1179976844 3 Left 1179976834 21:44873293-44873315 CCTGCCCGCGCCCCAGCCGCGAC 0: 1
1: 1
2: 6
3: 61
4: 634
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976839_1179976844 -8 Left 1179976839 21:44873304-44873326 CCCAGCCGCGACGGCAGCTCCCG 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976840_1179976844 -9 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976838_1179976844 -7 Left 1179976838 21:44873303-44873325 CCCCAGCCGCGACGGCAGCTCCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976836_1179976844 -1 Left 1179976836 21:44873297-44873319 CCCGCGCCCCAGCCGCGACGGCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39
1179976832_1179976844 5 Left 1179976832 21:44873291-44873313 CCCCTGCCCGCGCCCCAGCCGCG 0: 1
1: 0
2: 7
3: 83
4: 811
Right 1179976844 21:44873319-44873341 AGCTCCCGCGGCCGCCAAACGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179976844 Original CRISPR AGCTCCCGCGGCCGCCAAAC GGG Intronic