ID: 1179976850

View in Genome Browser
Species Human (GRCh38)
Location 21:44873345-44873367
Sequence GACCCTCGAGGAGCCTCCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 145}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179976834_1179976850 29 Left 1179976834 21:44873293-44873315 CCTGCCCGCGCCCCAGCCGCGAC 0: 1
1: 1
2: 6
3: 61
4: 634
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976847_1179976850 -8 Left 1179976847 21:44873330-44873352 CCGCCAAACGGGCGTGACCCTCG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976846_1179976850 -2 Left 1179976846 21:44873324-44873346 CCGCGGCCGCCAAACGGGCGTGA 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976845_1179976850 -1 Left 1179976845 21:44873323-44873345 CCCGCGGCCGCCAAACGGGCGTG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976840_1179976850 17 Left 1179976840 21:44873305-44873327 CCAGCCGCGACGGCAGCTCCCGC 0: 1
1: 0
2: 0
3: 20
4: 185
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976836_1179976850 25 Left 1179976836 21:44873297-44873319 CCCGCGCCCCAGCCGCGACGGCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976838_1179976850 19 Left 1179976838 21:44873303-44873325 CCCCAGCCGCGACGGCAGCTCCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976839_1179976850 18 Left 1179976839 21:44873304-44873326 CCCAGCCGCGACGGCAGCTCCCG 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976833_1179976850 30 Left 1179976833 21:44873292-44873314 CCCTGCCCGCGCCCCAGCCGCGA 0: 1
1: 0
2: 0
3: 22
4: 278
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976837_1179976850 24 Left 1179976837 21:44873298-44873320 CCGCGCCCCAGCCGCGACGGCAG 0: 1
1: 0
2: 0
3: 8
4: 198
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145
1179976842_1179976850 13 Left 1179976842 21:44873309-44873331 CCGCGACGGCAGCTCCCGCGGCC 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1179976850 21:44873345-44873367 GACCCTCGAGGAGCCTCCGTCGG 0: 1
1: 0
2: 2
3: 7
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179976850 Original CRISPR GACCCTCGAGGAGCCTCCGT CGG Intronic