ID: 1179979718

View in Genome Browser
Species Human (GRCh38)
Location 21:44889653-44889675
Sequence GGCGGCCACGTGGCTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1802
Summary {0: 1, 1: 0, 2: 2, 3: 344, 4: 1455}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179979718_1179979725 -8 Left 1179979718 21:44889653-44889675 CCCCCGCCAGCCACGTGGCCGCC 0: 1
1: 0
2: 2
3: 344
4: 1455
Right 1179979725 21:44889668-44889690 TGGCCGCCTCCTGGCCAGTCTGG 0: 1
1: 0
2: 1
3: 16
4: 172
1179979718_1179979731 17 Left 1179979718 21:44889653-44889675 CCCCCGCCAGCCACGTGGCCGCC 0: 1
1: 0
2: 2
3: 344
4: 1455
Right 1179979731 21:44889693-44889715 CTCCCCTGCCCTGCTGTGAATGG 0: 1
1: 0
2: 2
3: 53
4: 338
1179979718_1179979739 30 Left 1179979718 21:44889653-44889675 CCCCCGCCAGCCACGTGGCCGCC 0: 1
1: 0
2: 2
3: 344
4: 1455
Right 1179979739 21:44889706-44889728 CTGTGAATGGGACCTCAATAGGG No data
1179979718_1179979732 18 Left 1179979718 21:44889653-44889675 CCCCCGCCAGCCACGTGGCCGCC 0: 1
1: 0
2: 2
3: 344
4: 1455
Right 1179979732 21:44889694-44889716 TCCCCTGCCCTGCTGTGAATGGG 0: 1
1: 0
2: 1
3: 30
4: 291
1179979718_1179979738 29 Left 1179979718 21:44889653-44889675 CCCCCGCCAGCCACGTGGCCGCC 0: 1
1: 0
2: 2
3: 344
4: 1455
Right 1179979738 21:44889705-44889727 GCTGTGAATGGGACCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179979718 Original CRISPR GGCGGCCACGTGGCTGGCGG GGG (reversed) Intronic