ID: 1179979874

View in Genome Browser
Species Human (GRCh38)
Location 21:44890301-44890323
Sequence GGTGTTCTCCACCAAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179979874_1179979883 26 Left 1179979874 21:44890301-44890323 CCTTGCCCTTGGTGGAGAACACC 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1179979883 21:44890350-44890372 GGCCTACTGAGCACTTGCCACGG 0: 1
1: 0
2: 1
3: 19
4: 142
1179979874_1179979881 5 Left 1179979874 21:44890301-44890323 CCTTGCCCTTGGTGGAGAACACC 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1179979881 21:44890329-44890351 GGCACATTTTGCTTTCCTCGAGG 0: 1
1: 0
2: 0
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179979874 Original CRISPR GGTGTTCTCCACCAAGGGCA AGG (reversed) Intronic
901629331 1:10640661-10640683 GGTTTTCTACCCCAAGGGCTGGG + Intronic
905168434 1:36097078-36097100 GGGGTTTTCCTCCAAGGGGAAGG - Exonic
905517768 1:38574713-38574735 GGTGGACTGCTCCAAGGGCAAGG - Intergenic
908767131 1:67564403-67564425 GGTGATTTCCAACTAGGGCATGG - Intergenic
915113347 1:153578993-153579015 GGGGCGCTCCACCAAGGGCTTGG - Intergenic
915538922 1:156555207-156555229 GGTGCTCTAGACAAAGGGCACGG - Intronic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
919679791 1:200423105-200423127 TGTGAGCTCCATCAAGGGCAAGG - Intergenic
919847132 1:201649274-201649296 GCTGCTCTCCAGCAAGGCCAAGG + Exonic
923367523 1:233277466-233277488 GCTGTCCTCTACCATGGGCAGGG + Intronic
1064937641 10:20696224-20696246 GGTGTGCACCTCCAAAGGCATGG + Intergenic
1066059730 10:31711917-31711939 TGAGTTCTCCACCAAGTTCAAGG + Intergenic
1072654955 10:97323462-97323484 AGTGTTCTCCAGCATGGGAAGGG + Intergenic
1073112509 10:101071004-101071026 GGTGCTCCCCACCAAGAGGATGG - Intergenic
1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG + Intergenic
1074413814 10:113249749-113249771 GGTTTTCTCCTCCACGGGAAAGG + Intergenic
1075511053 10:123073377-123073399 GGTGGACTCCACGAAGAGCAAGG + Intergenic
1075518981 10:123132828-123132850 GGTGTTCTCCAGGAAGGACTCGG - Intergenic
1075949088 10:126462016-126462038 GGTCGTCTCCAGCAAGTGCAGGG - Intronic
1076126636 10:127979162-127979184 GTTGTCCTCCAGCAAGGGGAAGG - Intronic
1076344184 10:129769128-129769150 TTTGTACTGCACCAAGGGCATGG - Intergenic
1076610667 10:131723930-131723952 GGGATTCTCCACCAGAGGCAGGG + Intergenic
1078012432 11:7582934-7582956 AGCATTTTCCACCAAGGGCAAGG - Intronic
1078481359 11:11678754-11678776 TGGGTCCACCACCAAGGGCAGGG + Intergenic
1078527985 11:12114995-12115017 AGTGGTCTCCACCAAGCCCAGGG - Intronic
1079091086 11:17480727-17480749 GGTGTTCTTGTCCCAGGGCAGGG + Intergenic
1084399195 11:68933836-68933858 GGCGGTGTCCACCAAGAGCAGGG - Exonic
1086796807 11:91115297-91115319 GGTGTTCACAACATAGGGCAGGG - Intergenic
1087261840 11:96020885-96020907 GGTTTTATCCACCAAAGGCTAGG - Intronic
1088446548 11:109936252-109936274 GGTATTCTCATCCAATGGCATGG + Intergenic
1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG + Intronic
1090234217 11:125134604-125134626 GGTGCTCTTCACCAGGGGAATGG - Intergenic
1091697810 12:2639835-2639857 GGTGAGCTCCACCAAAGCCAAGG - Intronic
1092059391 12:5536151-5536173 GGTGGTGTCCAGGAAGGGCATGG + Intronic
1093275889 12:17125718-17125740 GCTGTTCTCCACCAGAGGCTAGG - Intergenic
1096615104 12:52827872-52827894 TGTGATCTCCAACAAGGCCAAGG - Intronic
1097993740 12:65864526-65864548 GGTGTTCTCTGCCAAATGCAAGG - Intronic
1099268126 12:80473949-80473971 GGTGGGTTCCACCAAAGGCAGGG + Intronic
1100963244 12:99985561-99985583 CGCGTTCTCCACCACGGCCAAGG - Intergenic
1102026364 12:109715982-109716004 GCTGTTCTACCCCAAGGTCAGGG + Intronic
1102808997 12:115807655-115807677 GGTGTTCTCCACTAAAGACAGGG - Intergenic
1104861159 12:131924602-131924624 GGTGTTCTCGAGGAAGGGGAAGG + Intergenic
1105241685 13:18614575-18614597 GGTGTCCTCCACCCAGGACTTGG + Intergenic
1105993729 13:25649722-25649744 GTTGTTGTCCTCCATGGGCAGGG + Intronic
1112507746 13:99985236-99985258 GGTGCTCTCCCCCAGGGGCCCGG + Intronic
1113290392 13:108899644-108899666 GGTGTGCTCCTCCAAGGGAAGGG + Intronic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1121277796 14:92679505-92679527 GGGGCTCTCCAGCGAGGGCAGGG + Intronic
1122972533 14:105158233-105158255 GGCGGCCTCCACCAAGTGCACGG + Intronic
1202863969 14_GL000225v1_random:103901-103923 GGGGTTCTCCACCCAGGCCATGG + Intergenic
1123579678 15:21704522-21704544 GGTGTGCTCCTCCAAGGGAAGGG - Intergenic
1123616305 15:22147033-22147055 GGTGTGCTCCTCCAAGGGAAGGG - Intergenic
1126164416 15:45642296-45642318 GGTCTTCTCCACCATGCACAAGG - Intronic
1126543557 15:49847411-49847433 GGTGTTCTATTCCAAGTGCAGGG + Intergenic
1129257540 15:74342609-74342631 TGTGTTCTCCACCAGGAGCTGGG + Intronic
1132118784 15:99158820-99158842 GGTGTTGGCCAACAAGGGCCGGG - Intronic
1202988548 15_KI270727v1_random:438767-438789 GGTGTGCTCCTCCAAGGGAAGGG - Intergenic
1137402951 16:48167982-48168004 GGTGTTCTCCAAGAAGGGGCAGG + Intronic
1140556796 16:75930628-75930650 GTGATTCTCCACCAAGGACATGG - Intergenic
1141705252 16:85661265-85661287 GGTGTTGTCCATCAGGGACACGG - Exonic
1141720685 16:85753634-85753656 GGGGTTCTCAGCCAAGGGCATGG - Intergenic
1143633709 17:8152529-8152551 AGTGGTCTCCACTAAGGTCAGGG + Intronic
1146279940 17:31538353-31538375 GGTGCTGTCCCCCAGGGGCAGGG + Intergenic
1147808081 17:43146749-43146771 TGTGTTCTCCTCCTAGGGCAGGG + Intergenic
1148279601 17:46337713-46337735 TGTGTTCTCCTCCTATGGCAGGG - Exonic
1148301818 17:46555569-46555591 TGTGTTCTCCTCCTATGGCAGGG - Exonic
1150825643 17:68472300-68472322 GGACTTCTCCACCCATGGCAAGG - Intergenic
1151327915 17:73390297-73390319 GGTGGTCACCACCAAGGCCTCGG + Exonic
1152215183 17:79027871-79027893 GATGGTCTCCAGCAGGGGCACGG + Intronic
1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG + Exonic
1152785949 17:82248155-82248177 GTTGTTCGCCAACAGGGGCAGGG - Intronic
1152965673 18:111969-111991 GGGGGTCTCCACCCAGCGCAGGG + Intergenic
1154447276 18:14445331-14445353 GGTGTCCTCCACCCAGGACTTGG - Intergenic
1155172997 18:23280919-23280941 GGAGTCCTCCACGCAGGGCATGG - Intronic
1157531428 18:48424088-48424110 GGTGTTCTCCCTCAAGGTTATGG + Intergenic
1157576285 18:48746082-48746104 GGCGTTCTCCGCCAAGAGCCTGG + Intronic
1160767707 19:815726-815748 GTTGGTCTCCACGTAGGGCATGG + Exonic
1161915140 19:7222726-7222748 TGTTTCCTCCACCAAGAGCAAGG - Intronic
1166251002 19:41570778-41570800 GGTGAGCTCCAGTAAGGGCAAGG + Intronic
1166256907 19:41613109-41613131 GGGATTCTCCATCTAGGGCAAGG - Intronic
1166861983 19:45816272-45816294 TGAGTTCTTCACCAAGAGCATGG + Intronic
1167476026 19:49701387-49701409 GGTGTCCTGCACAGAGGGCACGG - Exonic
1167726398 19:51215979-51216001 GGTGTTCTCCAGCAATGGAGAGG - Intergenic
926048904 2:9730559-9730581 GCTCTTCTCCAGCCAGGGCATGG - Intergenic
926131719 2:10307129-10307151 GGTCTTCTCCAGCAAGGGATGGG + Intronic
935700429 2:105807303-105807325 GGTGCTCTCCTCGAAGGGCAGGG + Intronic
938067758 2:128291319-128291341 GGTGCTCTGGACCCAGGGCAAGG - Intronic
940159252 2:150693705-150693727 GGTGCTTTCCACCCAGGTCAAGG - Intergenic
942889860 2:180977020-180977042 TGTGTCCTACACCAAGGGCTGGG - Intronic
944892225 2:204129292-204129314 GGTGTTCACCTCCAAGGGCGGGG - Intergenic
948253605 2:236550525-236550547 GGTGGTCTGCACCAAGGGTGAGG + Intergenic
1170959500 20:21012634-21012656 AGTGTTCTTCACCATGGACATGG - Intergenic
1174049650 20:47758867-47758889 GGGGTTCCCCATGAAGGGCAAGG - Intronic
1175830980 20:61965554-61965576 GGTGTCCTCCACGAAGGACGCGG + Intronic
1175929661 20:62487756-62487778 GGTGTTCTCCAGCCAAGGCCAGG - Intergenic
1177367017 21:20152172-20152194 GGTGTTCTCCATCAACAGCCCGG + Intergenic
1179979874 21:44890301-44890323 GGTGTTCTCCACCAAGGGCAAGG - Intronic
1180107870 21:45631686-45631708 GCTGGTCTCCCCCAAGAGCAGGG + Intergenic
1182799792 22:33022662-33022684 GGTGTTCTCCAACCAGAGGAGGG - Intronic
1184185508 22:42862295-42862317 GGTGTTGTCTTCCAGGGGCAAGG - Intronic
1185058035 22:48591467-48591489 TGTGCTCTCCATCCAGGGCAAGG - Intronic
949208377 3:1467888-1467910 CATGTTCTCCACTAAGGACATGG + Intergenic
952091071 3:29886947-29886969 AGGGTTCTCCATCAAGGGCTGGG + Intronic
952901217 3:38112734-38112756 GGTGAGCCCCACCAAGGGCGGGG - Intronic
953748679 3:45593980-45594002 GGTGTTCTCCAGCCAGGCCTGGG + Intronic
962901395 3:139765004-139765026 GGGATTCTCCTCCATGGGCAGGG + Intergenic
963046835 3:141108824-141108846 GGTCTTCTCCATCTAGGGAAAGG - Intronic
963112019 3:141695848-141695870 GGTGCTTTCCACCAAGGTGAAGG + Intergenic
965084853 3:164082064-164082086 TGTGTTCTCCAGCCAAGGCATGG - Intergenic
965495044 3:169388087-169388109 GCTGTTCTCCTCCTAGAGCAGGG - Intronic
966067998 3:175839757-175839779 GCTGTTCTCTCCTAAGGGCAAGG - Intergenic
966892583 3:184417982-184418004 GGTGCTCTCTGCCAAGGACAAGG - Intronic
968189901 3:196660125-196660147 GGTGTTCCCCGCCAGGGACACGG - Exonic
968509861 4:990874-990896 GCTGGTCCCCACCAAGGCCATGG + Intronic
984889449 4:184477942-184477964 GGTGTTCTCCTCCACGCCCAGGG + Intergenic
985222247 4:187719899-187719921 GCTGCTCTCTACTAAGGGCAAGG - Intergenic
985814791 5:2118671-2118693 TGTGTTCTCCAGCAAGGGTGAGG + Intergenic
986112046 5:4729065-4729087 GGTGTTCTCCAAGAAAGGGAAGG - Intergenic
987213652 5:15710319-15710341 GGTGTACTCCAGGAAGAGCAAGG - Intronic
990432322 5:55747960-55747982 GGTGTTTTCCACCATAGGCCAGG - Intronic
991573513 5:68079557-68079579 GCTCTTCTCCACAAAGGGCTTGG - Intergenic
992449152 5:76859975-76859997 GGTTTTCTGGATCAAGGGCAGGG + Intronic
994522722 5:100861913-100861935 TGTTTTATCCACCCAGGGCAAGG - Intronic
998216836 5:140244026-140244048 GGTGTTCTCCAGCTGGGTCATGG + Intronic
1001568053 5:172713255-172713277 GGGGTTCCCCAGCAAGGGGAAGG + Intergenic
1002334178 5:178466671-178466693 GGTGTTTTCCAGCATGGCCAAGG - Intronic
1003874317 6:10422936-10422958 GGTTTGCTCTGCCAAGGGCAGGG - Intergenic
1004997958 6:21212242-21212264 TGGGTTCTCCACCAGAGGCAGGG + Intronic
1006582735 6:35086158-35086180 GCTGGGCTCCCCCAAGGGCAAGG + Intronic
1007848609 6:44781870-44781892 GGGTTTCTCAAGCAAGGGCAGGG + Intergenic
1008914088 6:56767922-56767944 GGTGTACTCAAACAAGAGCAAGG + Intronic
1010809302 6:80280787-80280809 GGTCTTCTAAACCAAGGACATGG + Intronic
1010983598 6:82397063-82397085 GCTGTTCTCCACACATGGCAAGG - Intergenic
1012828620 6:104179190-104179212 GGTATTCCCCAGCAATGGCAAGG - Intergenic
1014910607 6:127088412-127088434 GGTGTTTTCCACCAAAGGAAAGG + Intergenic
1015020551 6:128468637-128468659 GGTGTTGTCCACCGAAGTCATGG - Intronic
1017753191 6:157507855-157507877 GGTGTTTTCCACCAAAAGCAGGG - Intronic
1018732561 6:166663455-166663477 CGGGTTCTCCACCACGGCCAAGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019907171 7:4073669-4073691 GGTGTGACCCACCAAGGTCAGGG + Intronic
1021235714 7:18140113-18140135 GGTGTTTTCCCCCAAAGCCAGGG + Intronic
1027246109 7:76368774-76368796 GGAGCTCTCCAGCAATGGCAGGG + Intergenic
1027516441 7:79147828-79147850 GGTGATCTGCACCCAGGGCCTGG - Intronic
1032012238 7:128354184-128354206 TGTGTTGTCCAGCTAGGGCATGG - Intronic
1032182297 7:129690720-129690742 AGTGCTCCCAACCAAGGGCATGG + Intronic
1037776801 8:21840955-21840977 GGTGGTCCCCACCCAAGGCAAGG - Intergenic
1048958834 8:139558868-139558890 GGGCTTCTCCACCAAGGGATGGG + Intergenic
1049256169 8:141615094-141615116 GCCCTTCTCCTCCAAGGGCAGGG + Intergenic
1050033823 9:1414103-1414125 GATGTTCTCCACCAATGACCTGG - Intergenic
1053397658 9:37788777-37788799 AGTGAACTCCCCCAAGGGCAGGG - Intronic
1054259398 9:62847551-62847573 TGTGTTCTCCAACAAAGCCAAGG + Intergenic
1054332379 9:63772487-63772509 TGTGTTCTCCAACAAAGCCAAGG - Intergenic
1058906140 9:109484147-109484169 GGTGTGCGCCACCCAGGGCAGGG - Intronic
1059381697 9:113932234-113932256 GCTGTTCCCCACCAATTGCAAGG - Intronic
1061774004 9:132948618-132948640 GGGGTTGCCCACCAACGGCAGGG - Intronic
1203740347 Un_GL000216v2:172115-172137 GGGGTTCTCCACCCAGGCCATGG - Intergenic
1186669612 X:11756567-11756589 GGTGTTCCCCACAAATGGCAGGG - Intergenic
1186919031 X:14257148-14257170 GGTGTAGTTCCCCAAGGGCAGGG - Intergenic
1188247814 X:27855791-27855813 GCAGTTCTCCACCTAGTGCAGGG + Intergenic
1189167648 X:38877033-38877055 GGTGCTCAACACCTAGGGCAAGG + Intergenic
1189285448 X:39849105-39849127 TGTGAGCTCCACGAAGGGCAAGG + Intergenic
1193170794 X:78333241-78333263 GGTGTTATCCTCCCAGGGCAGGG + Intergenic
1195678485 X:107525446-107525468 AATGTTCTCCATCAAGGGCCAGG - Intronic
1199519191 X:148716246-148716268 AGTGTCCTCCAACAAGGGGATGG - Intronic
1201178401 Y:11323211-11323233 GGTGGTCTCCACCCAGCACATGG - Intergenic