ID: 1179979919

View in Genome Browser
Species Human (GRCh38)
Location 21:44890553-44890575
Sequence CTGCTCCTGCGTGCCCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179979913_1179979919 28 Left 1179979913 21:44890502-44890524 CCATGCACATGGCCTGTGCTGCG 0: 1
1: 0
2: 0
3: 19
4: 197
Right 1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG 0: 1
1: 0
2: 0
3: 25
4: 230
1179979915_1179979919 16 Left 1179979915 21:44890514-44890536 CCTGTGCTGCGATACCGGTGCTC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG 0: 1
1: 0
2: 0
3: 25
4: 230
1179979918_1179979919 2 Left 1179979918 21:44890528-44890550 CCGGTGCTCTGTGAGTGGCTGGT 0: 1
1: 0
2: 1
3: 18
4: 245
Right 1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG 0: 1
1: 0
2: 0
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179979919 Original CRISPR CTGCTCCTGCGTGCCCCACA TGG Intronic
900336875 1:2168727-2168749 CTGCTCCTGGCTGCCCCTCGTGG - Intronic
900991188 1:6099167-6099189 CTGCTCCAACCTGCCCCACTGGG + Exonic
901029989 1:6301471-6301493 ATGCTCCTGCAGGCTCCACACGG + Intronic
902407321 1:16191842-16191864 CTGCTCCTGCTTGCCGCAGAAGG - Intergenic
903180280 1:21601796-21601818 CTGCCCCCGTGTGCCCCGCAGGG - Exonic
903211871 1:21823295-21823317 AGGCACCTGCCTGCCCCACACGG - Exonic
906098460 1:43240229-43240251 CTGCCCAGGAGTGCCCCACATGG - Intronic
910330915 1:86071850-86071872 CTGCTTCTGCTTGCCCTCCATGG - Intronic
913453382 1:119007677-119007699 CTTCTCCTTCCTCCCCCACAGGG - Intergenic
914992639 1:152511898-152511920 CTTCTCCTCCGTGCTCCTCATGG - Exonic
915287341 1:154861457-154861479 ATGCCCCTGTGTGCACCACACGG + Intronic
917670876 1:177272293-177272315 ATGCACCTACCTGCCCCACAGGG + Intronic
917845133 1:179014433-179014455 GTTCTCCTGTGTGCCCCAAAGGG - Intergenic
918098675 1:181354997-181355019 CTGCTGGTGCCTGCCCCACAAGG + Intergenic
919687840 1:200500827-200500849 CTGCTCCTGCGTGACTGAGAGGG + Intergenic
920504183 1:206505215-206505237 CTGCTGCTTCTTGCCCCACCAGG + Intergenic
920843832 1:209576989-209577011 CTGCTCCTCCCTGCCCCGCTGGG - Intergenic
922035692 1:221845872-221845894 CCTCTCCTGTGTGCCCCAAATGG - Intergenic
922739354 1:228006854-228006876 CTGCCCCTGCCTGCCCCGCCCGG + Intergenic
924024361 1:239817194-239817216 CTGGTCTTGCTTTCCCCACAGGG - Intronic
1063043438 10:2367982-2368004 CTGCTCCTCTGTGGCCCACGTGG + Intergenic
1065352305 10:24806585-24806607 CTGGTGGTGCCTGCCCCACAAGG - Intergenic
1066108669 10:32177657-32177679 CTGCCCCTGCTTTTCCCACAGGG + Intergenic
1066439905 10:35428483-35428505 CTGCTCCTGCCTACCTCTCAGGG - Intronic
1067787928 10:49264476-49264498 CTGGTCCTGCTTGCCACACATGG - Intergenic
1070593238 10:77815204-77815226 ATGCTCCTGCGCGTGCCACATGG + Intronic
1070719192 10:78744768-78744790 CTGCTTCAGCGCTCCCCACAGGG - Intergenic
1071770876 10:88727890-88727912 CTGCTGCTGCAGGCTCCACATGG - Intronic
1072044792 10:91643982-91644004 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1072850607 10:98887445-98887467 CTGATCCTGCGTTGTCCACATGG - Intronic
1074777556 10:116777443-116777465 CTCCTCCTTCCTGCCCCACCTGG + Intergenic
1075001618 10:118802739-118802761 AGGCTCCTGCAGGCCCCACAAGG - Intergenic
1076859343 10:133133253-133133275 CTGCTCCTCCGTGTCTCACGTGG + Intergenic
1076859348 10:133133279-133133301 CTGCTCCTCCGTGTCTCACGTGG + Intergenic
1076859353 10:133133305-133133327 CTGCTCCTCCGTGTCTCACGTGG + Intergenic
1078128778 11:8594365-8594387 CTGCTCCTCTGTGCCCCAGACGG - Intergenic
1079472431 11:20790702-20790724 CTGCTCCTGCCTGCTCTACGGGG + Intronic
1079797584 11:24825421-24825443 CTCCTCCTGCTTTCCCCACTTGG + Intronic
1085416435 11:76321857-76321879 CTGCCCATGCCCGCCCCACAAGG + Intergenic
1086552161 11:88065165-88065187 CTGCACCTGAGTGTCACACATGG - Intergenic
1087305670 11:96486970-96486992 CTGCTTCGGCTTGCCCCCCATGG - Intronic
1087382028 11:97417498-97417520 CTGCACCTTCATGTCCCACAAGG + Intergenic
1088995142 11:114989640-114989662 CTGCTCCTGCCTGCTGGACACGG - Intergenic
1089280121 11:117368384-117368406 CAGCTCCTGCCTGCCTCTCATGG - Intronic
1089658740 11:119971779-119971801 CTACTGCTGCTTGCCTCACAGGG + Intergenic
1096485317 12:51976354-51976376 CAGCTCCACCGGGCCCCACATGG - Exonic
1098959715 12:76727257-76727279 CTGCTCCTGAGTGTGCCAGAAGG + Intergenic
1100768825 12:97898602-97898624 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1102119384 12:110429032-110429054 CTGCTCTTCCCTGCCCCTCAAGG - Intergenic
1102489117 12:113278283-113278305 CTGCTCCTCACTGCCCCACGTGG - Intronic
1104081826 12:125435960-125435982 CTGCCCCTCGGTGCCCCACAGGG + Intronic
1104789402 12:131472452-131472474 CTGCTGCTCCATGCCCCGCACGG + Intergenic
1106042061 13:26103089-26103111 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1109731467 13:66419495-66419517 CTGCTTCTGCTTGCCCTCCATGG - Intronic
1109918783 13:69027703-69027725 CTGCTCCTGCATTTCCCATAGGG - Intergenic
1110422993 13:75334784-75334806 CTGTTCCTGCCTGGCCGACATGG - Intronic
1113420144 13:110164905-110164927 CTGGTCCTGAGGGCCCCCCAGGG - Exonic
1113631012 13:111883866-111883888 CTTCTCCTGCCTGCCTCCCATGG - Intergenic
1119211649 14:72836444-72836466 CTGCTCCTGCCTGCCCTGAAGGG + Intronic
1119355556 14:74003491-74003513 CTGCTCCTGTGTGGCCTCCACGG - Intronic
1121313090 14:92945711-92945733 CTGCTCCTGCGGTCCCCATAGGG + Intronic
1122331157 14:100914934-100914956 CAGATCCTGCATGCCTCACAGGG - Intergenic
1122987233 14:105218089-105218111 CTGCCCCTGGGTCCCACACAGGG + Intronic
1123059484 14:105588008-105588030 CTGCACCCGTGTTCCCCACAGGG - Intergenic
1123083819 14:105708278-105708300 CTGCACCCGTGTTCCCCACAGGG - Intergenic
1124045914 15:26149537-26149559 CTGCTCTCGAGGGCCCCACATGG + Intergenic
1125260645 15:37821024-37821046 CTGCTCCTGCCTGGCTCCCAGGG - Intergenic
1129726355 15:77903662-77903684 CTAGTCCTGCGTGTCCCTCAAGG - Intergenic
1131076255 15:89496637-89496659 CAGCTGCTCCGTGCCCCACGTGG - Intergenic
1131966494 15:97849361-97849383 CTGCTCCTGTCTGTGCCACAAGG - Intergenic
1132337194 15:101055576-101055598 CTCCTCCTGAGTGCCCTGCAAGG - Intronic
1132413385 15:101602916-101602938 CTGTTCCTGCATCCTCCACATGG + Intergenic
1132886985 16:2186669-2186691 GGGCTCCTGCCTGCCCCCCAGGG + Intronic
1136121754 16:28141006-28141028 TTGCTCTTGACTGCCCCACAGGG - Intronic
1136711624 16:32241468-32241490 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136756292 16:32687938-32687960 CTGCTCCTGCAGCCCCCACTGGG + Intergenic
1136811821 16:33182437-33182459 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136818297 16:33292517-33292539 CTGCTCCTGCAGCCCCCACTGGG - Intronic
1136824861 16:33349050-33349072 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1136829927 16:33447821-33447843 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1137783363 16:51116125-51116147 ATGCTCCTGCTTGGCCCACAAGG + Intergenic
1139916344 16:70430673-70430695 CTGCTCCTTCCTGTCCCAAAGGG - Intronic
1141464117 16:84195543-84195565 CAGCTCCTGCTGGCCACACAGGG + Exonic
1141908516 16:87042967-87042989 CTGCTGCTGCGTGCGGGACATGG - Intergenic
1142363058 16:89636307-89636329 CTGCTCCAGCGTCCTCCGCACGG - Exonic
1202990399 16_KI270728v1_random:5405-5427 CTGCTCCTGCAGCCCCCACTGGG - Intergenic
1203058430 16_KI270728v1_random:948291-948313 CTGCTCCTGCAGCCCCCACTGGG + Intergenic
1143711876 17:8741278-8741300 CTGCTCCCCAGTGCCCCCCAGGG + Intronic
1146746422 17:35334225-35334247 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1146937934 17:36824135-36824157 CTGCCCCTGCTGGCCCCAAAGGG + Intergenic
1148123397 17:45224956-45224978 CTGACCCTGCGTGCCTCCCAGGG - Intronic
1148354765 17:46968445-46968467 CTGCTCCAGCGGTCCCCGCATGG - Intronic
1151578355 17:74963910-74963932 CTGCTCCTGCCTGCCCCCACAGG - Exonic
1151759016 17:76090241-76090263 CTGCTCCTGCCTGGCCCAGCTGG - Intronic
1151764252 17:76124119-76124141 CTGCTCCTGCCTCCCACAAAAGG + Intergenic
1152406751 17:80102171-80102193 CTGCTCCTGCAGGACGCACATGG + Intergenic
1152920056 17:83062092-83062114 CTGCCCCTCCCTGCCCCAGAGGG - Intergenic
1153798374 18:8646569-8646591 CTGCTTCTGCTTGCCCTCCAGGG - Intergenic
1154168067 18:12030560-12030582 CTGCTCCTGGCTACCCCAGAGGG + Exonic
1155054928 18:22174086-22174108 CTGCTCCTGGGAGCCAAACACGG - Intronic
1155835356 18:30575348-30575370 CTGCTGCATCGTGCCCAACATGG + Intergenic
1156448341 18:37253146-37253168 CGGGCCCTGCCTGCCCCACACGG - Intronic
1160194285 18:76739578-76739600 CTCCTGCTGTGTGGCCCACACGG + Intergenic
1160492511 18:79349960-79349982 ATTCTCCTGCGTGCTCTACAAGG + Intronic
1161700139 19:5790001-5790023 CTGCTCCTGCCTGCCCCGGCAGG + Intronic
1161738861 19:6008060-6008082 CAGCTCCTGCGTGTCCCTCCCGG - Intronic
1162438639 19:10679330-10679352 CTGCTCCTGCTTGCCACACCTGG + Intronic
1163439208 19:17313013-17313035 CTGTTCCTGCCTGTCCCAGAGGG + Intronic
1164709828 19:30347815-30347837 ATGCTCCTAGCTGCCCCACAGGG + Intronic
1166500960 19:43340947-43340969 CTGGTCCTGAGACCCCCACAGGG - Intergenic
1166625083 19:44344471-44344493 CTGCTCCCTCCTGCCCCACCTGG + Intronic
1166738604 19:45100787-45100809 CCCCTCCTGCGTGCCCACCAAGG - Intronic
1166800870 19:45456160-45456182 TTTCTCCTTCCTGCCCCACATGG - Intronic
1167671976 19:50858800-50858822 CTGTTCCTGCGTTCAGCACACGG + Intronic
1167749335 19:51370509-51370531 CTGCTCCTGGCTGCCCCTCAGGG + Intergenic
1168450360 19:56461969-56461991 CTGCTACTGCAGGCCCCACCTGG + Intronic
926149974 2:10420032-10420054 CTGCTCCAGCTTGCCCCGCGAGG - Exonic
929533773 2:42767954-42767976 CTGGTGCTTCTTGCCCCACATGG + Intronic
932160778 2:69457395-69457417 CTACTCCTGTGTTCCCTACATGG + Intergenic
932493999 2:72137691-72137713 CTGCTCCTGCCTGCCCTCTAGGG - Intronic
935221897 2:101022365-101022387 CTGGACCTGCGGGGCCCACACGG - Exonic
937357557 2:121207707-121207729 CTGCTCCTGCACGCCCCAGAAGG - Intergenic
938407300 2:131039691-131039713 CTGCTCCTGCCAGCCCCAGCGGG - Intronic
939640933 2:144638982-144639004 CTGCTTCTGCTTGCCCTACTTGG + Intergenic
939937851 2:148313940-148313962 CTGCTTCTGCTTGCCCTCCATGG + Intronic
940326867 2:152434669-152434691 CTACTCCTGCTTGCCCCAGAGGG + Intronic
940408168 2:153329104-153329126 CTGCTCCTGCTTGCCTTCCATGG + Intergenic
942053602 2:172162897-172162919 CTGCTCCTGCCTGCTCCATGGGG + Intergenic
942341808 2:174956925-174956947 CTGCTCCTGGGGGCAACACAGGG + Intronic
945803392 2:214461699-214461721 CTGCTCCTGTGTGTACCACTAGG - Intronic
946248049 2:218398423-218398445 CTGCTCCTGGGTAGCCCACGGGG - Intronic
948512008 2:238474747-238474769 CTGGGCTTCCGTGCCCCACAGGG + Intergenic
948868794 2:240788075-240788097 CTTCTCCTGCTTGCCCATCATGG + Exonic
948949222 2:241238249-241238271 CTGCAGCTGCCTGCCTCACAGGG + Intronic
1169273353 20:4217152-4217174 CTGCACCTGCATCCACCACAGGG - Intergenic
1169412409 20:5382979-5383001 CAGCTCCTGAGTGCACCTCAAGG + Intergenic
1169960420 20:11153060-11153082 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1172881620 20:38203502-38203524 CTGCTCCTGCCTGGCGCACCTGG + Intergenic
1174134904 20:48372890-48372912 CTGCTCCAGAGTCCCCCACATGG - Intergenic
1175248756 20:57596740-57596762 CAGCTCCTGCGTGACTCCCAAGG - Intergenic
1175825213 20:61933294-61933316 CTGCACCTGCATCCCCCACGGGG + Intronic
1176230992 20:64032824-64032846 CTGCTCCTGGGGGGACCACAGGG - Exonic
1176268985 20:64225654-64225676 CTGCTTCTGAGTGCCCCATCTGG - Intronic
1177805531 21:25871361-25871383 ATGCTCCTGTCTGCTCCACACGG + Intergenic
1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG + Intronic
1180160075 21:45995210-45995232 CTGGTCCTGCGTGCCGCTCACGG + Intronic
1180609642 22:17086764-17086786 ATGCTCCTGCTACCCCCACAGGG - Intronic
1180699129 22:17772325-17772347 CTGCCCCTGCCCACCCCACAGGG - Intronic
1181053617 22:20249072-20249094 CTGCTCCTCCATGCTCCACCAGG + Intronic
1181817249 22:25447898-25447920 CTGCTCCCTGGTGTCCCACAAGG + Intergenic
1182548660 22:31089792-31089814 CTCCTGCTGCGAGCCCCACCTGG + Exonic
1183163229 22:36128659-36128681 ATCCTCCTCCGTACCCCACAAGG + Intergenic
1184096244 22:42317961-42317983 CTGGGCCTGCCTGCCCCATAGGG - Intronic
950237602 3:11337112-11337134 CTGCTCCTGCTTGCCCACTATGG + Intronic
953586477 3:44205828-44205850 CAGTTCCTGGGAGCCCCACATGG + Intergenic
954367146 3:50152285-50152307 CAGCTCCTGCGTGCCTATCAGGG + Intergenic
954581063 3:51703193-51703215 CTGCTCCTGGGAGCCCTGCACGG + Intronic
956162845 3:66372984-66373006 CTTCACCTGCGTGGACCACACGG - Intronic
959345667 3:105191476-105191498 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
961714926 3:128851738-128851760 CTCCTCCTGGGTCTCCCACATGG + Intergenic
961734497 3:128993088-128993110 CAGCTCCGACGTGCCCCACGTGG - Exonic
962064293 3:131963092-131963114 CTGCTTCTGCTTGCCCTACATGG - Intronic
963071892 3:141311524-141311546 CTGCCCCTGCGTCCCCATCATGG + Intergenic
965488372 3:169306856-169306878 CTTCTCCTCCTTACCCCACAGGG + Intronic
965806635 3:172548893-172548915 TTGCCCCTCCGTGCCCCACTAGG + Intergenic
967844417 3:194032663-194032685 CTGCTGCCGCCTGCCCCATAAGG - Intergenic
968620219 4:1600535-1600557 CTGTCCCTGCAGGCCCCACACGG + Intergenic
968755186 4:2412045-2412067 CTGCCCCTGCCTGCGCCCCAGGG - Intronic
969164905 4:5299097-5299119 CTGCTTCTGCTTGCCCTTCATGG + Intronic
969716594 4:8871066-8871088 GGGCTCCTGGGGGCCCCACAAGG + Intronic
973809202 4:54553648-54553670 CAGGTCCTGCCTGCCACACAAGG + Intergenic
975329789 4:73100039-73100061 CTGCTCCTCCCTGCCCCCCAAGG + Intronic
977132806 4:93264665-93264687 TTGGTCCTGAGTCCCCCACAAGG + Intronic
980494246 4:133570589-133570611 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
982178449 4:152728283-152728305 CTGCTCCTTCGGGTCCCTCAAGG - Intronic
982393534 4:154891827-154891849 CTGCTTCTGCTTGCCCAACATGG - Intergenic
985659687 5:1150878-1150900 CTGCTTCTGCGTGCCCTCCTGGG - Intergenic
986358455 5:6951959-6951981 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
986438135 5:7755325-7755347 CTGGTCCTGCGTCTCCCTCAGGG + Intronic
986879509 5:12153351-12153373 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
988501070 5:31784201-31784223 CTGCCTGTGAGTGCCCCACATGG + Intronic
989320796 5:40131351-40131373 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
991425092 5:66482487-66482509 CTGCTCCTGCCAGCCTCAGATGG + Intergenic
992429543 5:76695154-76695176 CTGCTACTTTGTTCCCCACATGG - Intronic
992444162 5:76819445-76819467 CTGCTCCCGCATGTCCCACCTGG - Intronic
999556727 5:152751808-152751830 CTGCTTCTGCTTGCTCCACATGG - Intergenic
1001292689 5:170475339-170475361 CAGCTCCTGCGTGCCAGGCATGG + Intronic
1002136184 5:177109155-177109177 CTCCTCCTGCCTTCCCCACACGG - Intergenic
1002505937 5:179679149-179679171 GAGCACCTGCGTGCCCTACAAGG - Exonic
1002836359 6:868549-868571 CTTTCCCAGCGTGCCCCACAGGG + Intergenic
1003306645 6:4934981-4935003 CAACTCCTGAGTGTCCCACAGGG + Intronic
1004053588 6:12112706-12112728 CTGCTGCTGCTTCCCCCACAGGG + Intronic
1004191077 6:13464157-13464179 CTGCTCCACAGTGCCACACATGG + Intronic
1004944552 6:20596942-20596964 CTGCTTCGGCTTGCCCCCCATGG + Intronic
1005801181 6:29426932-29426954 CTTCTCCTGCTTGCCCCAGCAGG + Exonic
1006474538 6:34245791-34245813 CTGCTCCTCCCTGCCCCCCAAGG + Exonic
1006644416 6:35506097-35506119 GTGCTCCGGCCTGCCCCCCAGGG - Exonic
1007219209 6:40265202-40265224 CTGCTCCAGAGTGCCCCACCAGG + Intergenic
1007237615 6:40402068-40402090 CTCTTCCTGCGAGCCCCAAAGGG + Intronic
1010581970 6:77610367-77610389 CTCCTGCTGCCTGCTCCACACGG - Intergenic
1013348460 6:109284869-109284891 CTACTCTTGAGTGACCCACAGGG + Intergenic
1013980199 6:116120828-116120850 TTGCTCCTGCTGGGCCCACAGGG + Exonic
1014278757 6:119417807-119417829 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1017786623 6:157762100-157762122 CTGCCCCTCCCGGCCCCACAGGG - Intronic
1017786636 6:157762140-157762162 CTGCCCCTCCCGGCCCCACAGGG - Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1019522507 7:1467208-1467230 GTCCTGCTGGGTGCCCCACACGG + Intergenic
1019777113 7:2918452-2918474 CTGCCCCTGCTGCCCCCACAGGG + Intronic
1020715971 7:11675108-11675130 CTGCTTCTGCTTGCCCTCCATGG - Intronic
1023512578 7:40969013-40969035 CTGCTCCAGCCGGCCCCACGAGG + Intergenic
1024017640 7:45332687-45332709 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1024034748 7:45497720-45497742 CTGCTTCTGGGAGCCCCAGAAGG + Intergenic
1024664996 7:51537078-51537100 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1025035419 7:55590283-55590305 CTCCTCCTTCCTGCCCCACAGGG + Intergenic
1030875360 7:114807004-114807026 CTGATGTTGCTTGCCCCACAGGG - Intergenic
1031397824 7:121293807-121293829 CTGCTTCTGCTTGCCCTCCATGG + Intronic
1031613855 7:123857482-123857504 CTGCTTCTGCTTGCCCTCCATGG + Intronic
1032264796 7:130363306-130363328 TTGCTCCTCCCTGCCCCACTAGG + Intronic
1032957204 7:136984746-136984768 CTGCTTCTGCTTGCCCTCCATGG + Intronic
1033044005 7:137944260-137944282 CTGCACCTTCGTTCCACACACGG - Intronic
1034531074 7:151696860-151696882 CTGCTGCTGCCAGCTCCACAGGG - Intronic
1040603896 8:48910847-48910869 CTGCTCCTGCGCGCTCTGCAGGG - Intergenic
1044595357 8:93953570-93953592 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1048956000 8:139536499-139536521 CTATTCCTGCATGCCCCACAAGG + Intergenic
1049153844 8:141055261-141055283 CTGCTCCAGCTTGGCCCTCAGGG + Intergenic
1049694560 8:143977008-143977030 CTGCGCCGGCGTGCGCGACACGG + Intergenic
1049765649 8:144354144-144354166 CTGCACCTGCGGGCGCCACGCGG + Exonic
1049858816 8:144883197-144883219 GTGCTGCTGTCTGCCCCACAAGG - Intronic
1052374314 9:27700672-27700694 CTGCTCATGGGGGCCCCACGTGG + Intergenic
1054788172 9:69229618-69229640 CTCCTCCTCCCTCCCCCACACGG - Intronic
1055210236 9:73782882-73782904 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1056577809 9:87869309-87869331 CAGCGCCTGCATGCCCCCCAGGG + Intergenic
1058624582 9:106921458-106921480 CTTCTCCTCCGTGCACAACATGG - Intronic
1059653598 9:116337300-116337322 CTCCTCCTGAGTGCCCCAGTGGG + Intronic
1061283167 9:129608897-129608919 CTGCTTCTTCCTGCCGCACATGG - Intronic
1061403917 9:130383330-130383352 CCGCTCCTGAGCGCCACACAAGG + Intronic
1061572898 9:131488611-131488633 CTGCTCCTGCAGCCCCCAGACGG + Intronic
1061712212 9:132496243-132496265 ATGAGCCTGTGTGCCCCACAAGG - Intronic
1062017314 9:134297298-134297320 CTGCTCCTGCCTGCCCCAGTAGG + Intergenic
1062236684 9:135513644-135513666 CTGGCCCTGCGTGGCCCACGTGG + Intergenic
1062612987 9:137383319-137383341 CCGCTCCCGCGTGGACCACAGGG + Exonic
1062732514 9:138118057-138118079 GTGCTCCTGACCGCCCCACAGGG - Exonic
1188156645 X:26749262-26749284 CTGCTCCTCCCTGCCCCCCAAGG + Intergenic
1190301696 X:49060774-49060796 GTCCTCCTGCCTGCCCCATAGGG - Intronic
1192766029 X:74140477-74140499 CTGCTTCTGCTTGCCCTGCATGG - Intergenic
1192884348 X:75320830-75320852 CTGTTTCTGCTTGCCCCCCATGG + Intergenic
1192934033 X:75839549-75839571 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1193228500 X:79013717-79013739 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1193254105 X:79325982-79326004 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1193404395 X:81083776-81083798 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1195140018 X:101950011-101950033 CTGCTTCTGCTTGCCCTCCATGG - Intergenic
1195810711 X:108825509-108825531 CTGCTTCTGCTTGCCCTCCATGG + Intergenic
1196561496 X:117154555-117154577 CTGCTCCTGCATGACCTACTTGG + Intergenic
1197763974 X:130047426-130047448 CTCCTCCTGTGTGCCACTCATGG + Intronic
1200081172 X:153577189-153577211 CTACTCCAGCGTGCCCCTCCCGG - Intronic
1201543142 Y:15131527-15131549 CTGCTTCTGCTTGCCCTCCATGG - Intergenic