ID: 1179979920

View in Genome Browser
Species Human (GRCh38)
Location 21:44890556-44890578
Sequence CTCCTGCGTGCCCCACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179979918_1179979920 5 Left 1179979918 21:44890528-44890550 CCGGTGCTCTGTGAGTGGCTGGT 0: 1
1: 0
2: 1
3: 18
4: 245
Right 1179979920 21:44890556-44890578 CTCCTGCGTGCCCCACATGGTGG 0: 1
1: 0
2: 0
3: 11
4: 152
1179979915_1179979920 19 Left 1179979915 21:44890514-44890536 CCTGTGCTGCGATACCGGTGCTC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 1179979920 21:44890556-44890578 CTCCTGCGTGCCCCACATGGTGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179979920 Original CRISPR CTCCTGCGTGCCCCACATGG TGG Intronic
900411733 1:2515627-2515649 CTCCTACGTGCCCGACACGGTGG - Exonic
902407320 1:16191839-16191861 CTCCTGCTTGCCGCAGAAGGAGG - Intergenic
904852139 1:33467333-33467355 CTCCTGTTTGCCCCACCTGCGGG + Intergenic
913243553 1:116851717-116851739 CTCCTGGGTGCCACACACTGAGG - Intergenic
920342802 1:205286136-205286158 CCTCTGCCTGCCCCCCATGGAGG + Intergenic
1067944936 10:50683445-50683467 CTCCTGCTTGCACCACACAGGGG - Intergenic
1068480277 10:57580487-57580509 CTTCTTCCTGCCCCACATGATGG + Intergenic
1070264173 10:74886555-74886577 CTCCCCCGTGCCCCACATCTGGG + Intronic
1070424240 10:76269921-76269943 TTCCTGCCTACACCACATGGTGG - Intronic
1071967497 10:90867293-90867315 ATCCTCTGTGTCCCACATGGTGG - Intergenic
1073206030 10:101769920-101769942 TTCCTCCCTGCCCCACCTGGGGG + Intergenic
1073510726 10:104040903-104040925 TTCCTGCTTGCTGCACATGGAGG - Intronic
1073986082 10:109210786-109210808 CTGCAGTGAGCCCCACATGGCGG - Intergenic
1077134569 11:992024-992046 TTCCTGCGAGCCTCACCTGGGGG - Intronic
1077359511 11:2134433-2134455 CTCTTGCCTGCCCCATTTGGGGG - Intronic
1077363485 11:2151660-2151682 CTCCAGAGTGCCCCAAATTGCGG - Intronic
1078908955 11:15713200-15713222 CTGCTATGTGCCTCACATGGTGG + Intergenic
1082708708 11:56526764-56526786 CACCTGCGGGTCCCACCTGGTGG - Intergenic
1087752799 11:102024203-102024225 ATCCTACATGCCCCACATTGAGG + Intergenic
1089189049 11:116641163-116641185 CCCCCTCCTGCCCCACATGGAGG + Intergenic
1091770705 12:3149317-3149339 CTCCTTCCTGCCACACTTGGAGG - Intronic
1095334910 12:41012572-41012594 CTCCTTCCAGCCCCACATGACGG + Intronic
1102573621 12:113842613-113842635 CCCGTGCCTTCCCCACATGGGGG - Intronic
1103740090 12:123085231-123085253 CATCTGCGTGACCCAGATGGGGG + Intronic
1104081828 12:125435963-125435985 CCCCTCGGTGCCCCACAGGGAGG + Intronic
1104649222 12:130519582-130519604 CTTCAGCATGTCCCACATGGGGG + Intronic
1105704407 13:22960500-22960522 CTCCTGAGTGTCCCTGATGGTGG + Intergenic
1111526346 13:89476266-89476288 CTCCTCTGTGCCCCACAAGCAGG + Intergenic
1112184153 13:97112164-97112186 CTCCTGCATGCCTCCCATGTGGG - Intergenic
1113710054 13:112457285-112457307 CTCCTGGGTGCCCCAGACAGGGG - Intergenic
1113950183 13:114067134-114067156 CTCCAGAGTGCCCCAGGTGGGGG - Intronic
1115289950 14:31759001-31759023 CTCCTATGTGCCATACATGGAGG - Intronic
1118737850 14:68715059-68715081 CTCCTCCCTGCCCCACGAGGAGG + Intronic
1120979922 14:90280357-90280379 CTCCTGCGTGTCCTCCCTGGTGG + Intronic
1122097967 14:99385179-99385201 CTCCTCAGTGCCCCATATGCGGG + Intergenic
1122858242 14:104570324-104570346 CTCCTGGGTGCTCCACATCGAGG + Intronic
1122877987 14:104677615-104677637 CTCCTCCCTGCCCCACCTCGGGG - Intergenic
1123941799 15:25220251-25220273 CTACTGCCTTCCCCACATGGAGG + Intergenic
1123945682 15:25237742-25237764 CCACTGCCTTCCCCACATGGAGG + Intergenic
1128511477 15:68316345-68316367 CTCCTCCCTGCCCCACCTGGGGG + Intronic
1128685394 15:69680757-69680779 CTCCCTCATGCACCACATGGAGG - Intergenic
1130424035 15:83777072-83777094 CTTCTGTGTGCCCCACAAGTAGG - Intronic
1130442814 15:83972689-83972711 CTCCTGCCTGCCAAACATGTAGG + Intronic
1132789161 16:1675469-1675491 CTGCAGCGTGCCACACATGTGGG - Exonic
1132886986 16:2186672-2186694 CTCCTGCCTGCCCCCCAGGGTGG + Intronic
1133125035 16:3641190-3641212 CTCCCCTGTGGCCCACATGGAGG - Intronic
1135950435 16:26909426-26909448 CTCCTGCTTTCCCCACGTGACGG + Intergenic
1141464120 16:84195546-84195568 CTCCTGCTGGCCACACAGGGGGG + Exonic
1141886664 16:86896934-86896956 CTCCTCCGTGACCCACCTGCGGG - Intergenic
1143870075 17:9951826-9951848 CTCCTGCCTGCCCCACGTTTTGG - Intronic
1144622277 17:16825078-16825100 CTCCAGCCTGCCCCAAAAGGAGG + Intergenic
1145148082 17:20496742-20496764 CTCCAGCCTGCCCCAAAAGGAGG + Intergenic
1147574248 17:41589409-41589431 CTCCAGCCTGCCCCAAAAGGAGG + Intergenic
1148354764 17:46968442-46968464 CTCCAGCGGTCCCCGCATGGAGG - Intronic
1148838439 17:50478947-50478969 CTCCTGCGTTCTCCACGCGGCGG - Exonic
1148888228 17:50788876-50788898 CTCCTGCTTCCCCCACACTGTGG - Intergenic
1150124084 17:62625701-62625723 CTCCTGTGTGCCCGGCATGGCGG + Intergenic
1150650372 17:67006109-67006131 CTCCTCACTGCCCCTCATGGTGG - Intronic
1152002246 17:77654188-77654210 CTCCTTCGTGGCCCACATCACGG + Intergenic
1152657580 17:81527210-81527232 CTCCTGAGTGGCCATCATGGGGG - Intergenic
1152662259 17:81547993-81548015 CCCCTGCGTGGCCCAGATGTGGG - Intronic
1160444130 18:78914080-78914102 CTCCTGCAAGCCACACCTGGTGG - Intergenic
1161173303 19:2824189-2824211 CTCCTGCCTCGCCCACTTGGAGG + Intronic
1162518582 19:11165531-11165553 CCCCTCCCTTCCCCACATGGAGG - Intronic
1163369476 19:16893894-16893916 GTCCTGGGTGCCCCAAAGGGAGG + Intronic
1165808506 19:38596484-38596506 CTGCTGCGGGCCGCACAGGGAGG + Exonic
1168204529 19:54839865-54839887 CTCCTGCATGGCCTGCATGGAGG + Intronic
925366997 2:3317467-3317489 CTACTGTGTGCCTCACATGCGGG + Intronic
925694983 2:6567067-6567089 CTCCTCCAGGACCCACATGGGGG + Intergenic
925719907 2:6817255-6817277 CACCTGCCTGCCCCAGCTGGTGG - Intergenic
926174256 2:10574998-10575020 CTCCTGAATCCGCCACATGGCGG - Intronic
929556720 2:42930062-42930084 CTCCTGTCTTCCCCACAAGGAGG - Intergenic
936522125 2:113218002-113218024 CTCCCGCCTGCCCCACACGGAGG - Exonic
937043462 2:118838001-118838023 CACCTGCATGCCCCAGCTGGTGG - Intergenic
939041495 2:137194221-137194243 CTCCTGCATTCCCCAAAGGGTGG - Intronic
941804301 2:169694671-169694693 CACCTGCGCGCTCCCCATGGGGG + Exonic
943526182 2:189020494-189020516 CTCCTGCCTGCTCCACAGAGTGG - Intergenic
947739005 2:232476413-232476435 CACCTCCATGCCCCCCATGGGGG - Intergenic
1168964488 20:1891047-1891069 TGCCAGCGTGCCCCACAGGGTGG + Intergenic
1171354604 20:24534315-24534337 TCCCTGAGTGCCCCAGATGGAGG - Intronic
1172619613 20:36310341-36310363 CTCCTGAGTGGGCCACAGGGAGG + Intronic
1173837600 20:46136088-46136110 CTCCTGCCTGCCTCACTTTGGGG - Intergenic
1175496367 20:59417144-59417166 AGCCAGCGTGCCCCAGATGGTGG - Intergenic
1179979920 21:44890556-44890578 CTCCTGCGTGCCCCACATGGTGG + Intronic
1181510561 22:23386980-23387002 CTCGGGGGTGCCCCACAGGGTGG + Intergenic
1181646185 22:24232805-24232827 CTGCGGTGAGCCCCACATGGTGG - Exonic
1182051566 22:27316359-27316381 CTGTAGCCTGCCCCACATGGTGG + Intergenic
1183966955 22:41447715-41447737 CTCCCGCGTGCCCCACACTGGGG - Intergenic
1184348352 22:43926451-43926473 CACCTCCATGCCCCACATAGAGG - Intronic
1185077966 22:48693512-48693534 CTCCTGCGGGCCTCACCTGCTGG - Intronic
1185165927 22:49262238-49262260 CTCCTCTCTGCCTCACATGGTGG + Intergenic
952684534 3:36132980-36133002 CTCCTGTGTGCCCCAACTGAAGG + Intergenic
953244875 3:41181875-41181897 CTACTGCGAGCCCCTCATAGAGG - Intergenic
954372349 3:50175410-50175432 CTCCTGTCTTCCCCACCTGGCGG - Intronic
955387454 3:58491406-58491428 CTCCTGCCTGCCCTGCATTGGGG - Intergenic
955475902 3:59335801-59335823 CTCCTGTGTACCCAACCTGGGGG + Intergenic
961481559 3:127183979-127184001 CACCTGCCTGGCCCCCATGGTGG + Intergenic
961895064 3:130160069-130160091 CACCTGCATGCCACACAAGGGGG - Intergenic
964356956 3:155859668-155859690 CTCCTGCCGGCCGGACATGGTGG - Intergenic
965423353 3:168490221-168490243 CTCCTTCTGCCCCCACATGGGGG + Intergenic
966949188 3:184800763-184800785 CTTCTGCCTGACCAACATGGTGG + Intergenic
968528415 4:1076627-1076649 GTCCTCCCTGCCCCACATGATGG - Intronic
969220069 4:5753487-5753509 CCCCTTCCTGCCCCACATGCTGG - Intronic
969504570 4:7576847-7576869 CTCATGCGTGCCCCACCCAGCGG + Intronic
972640993 4:40924700-40924722 TTCCTGCCTGATCCACATGGGGG - Intronic
975634948 4:76438951-76438973 CTAATACATGCCCCACATGGAGG - Intronic
975783374 4:77862833-77862855 ATCCGGAGTGCCCAACATGGCGG + Exonic
986051681 5:4096198-4096220 CTCCTGCCTGCCCCACCGTGTGG + Intergenic
986759062 5:10863513-10863535 CTCCCACGTGTTCCACATGGCGG + Intergenic
991425093 5:66482490-66482512 CTCCTGCCAGCCTCAGATGGTGG + Intergenic
995691436 5:114830151-114830173 CTTCTCTGTGCCCCACAAGGAGG - Intergenic
997384849 5:133464606-133464628 CTCCTACCTTCCCCCCATGGAGG + Intronic
1001465133 5:171957445-171957467 AGCCTGGGTGCCCCACATGGAGG - Intronic
1001962496 5:175888057-175888079 CTGCTGTATGCCACACATGGGGG + Intergenic
1001963211 5:175893053-175893075 CTCCAGTGTCCCCCACATTGTGG + Intergenic
1004828943 6:19456229-19456251 CTCCTTCGTGCCTCACTTAGAGG - Intergenic
1006105313 6:31712831-31712853 CCTCTGCCTGCCCCACAGGGAGG - Intronic
1013219204 6:108062254-108062276 CTCCTGAGTGCCTCACAGGAGGG + Intronic
1015525514 6:134172193-134172215 CTCCGGCGTGCCACAGAAGGTGG + Exonic
1016588518 6:145716803-145716825 CTCCTGTCTCCCTCACATGGAGG + Intronic
1018713667 6:166515234-166515256 CTCCTGCAGTCCCCACCTGGTGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019058128 6:169237230-169237252 CTCCCCAGTGCCCCAGATGGGGG - Exonic
1019064874 6:169288350-169288372 CTCCTGGGTTACACACATGGGGG - Intergenic
1019603096 7:1895065-1895087 CTCCTGGGTTCCCCAGATGTGGG - Intronic
1019749405 7:2719256-2719278 CTCCCGCCTGCACCACTTGGAGG + Intronic
1019961673 7:4465699-4465721 CTCCTGCCTGCCCCACGCTGTGG - Intergenic
1022246396 7:28563990-28564012 CTCCTGAGAGCACCAAATGGAGG + Intronic
1023361689 7:39423432-39423454 CTCCTGTGTGCCTGGCATGGGGG - Intronic
1026049284 7:66931501-66931523 CTCCAGCCTGGCCAACATGGTGG - Intronic
1026524456 7:71142155-71142177 CTCCTGAGGGCCCCGCATAGTGG - Intronic
1026894239 7:74000752-74000774 TTCCTCCATGCCCCACTTGGCGG - Intergenic
1028764172 7:94531945-94531967 ATCTTGCCTGCCCCACAGGGTGG + Intronic
1030080502 7:105773914-105773936 CTCCCCGGTGCCCCACATGCAGG - Intronic
1032080427 7:128855966-128855988 CTCCTGGCTGCCCCTCAGGGTGG + Intronic
1032584617 7:133134781-133134803 CTCCTGCTGGCCCCACACAGTGG - Intergenic
1033473032 7:141665914-141665936 CTCCTCCGTCCCCCATCTGGTGG + Intronic
1033667595 7:143457238-143457260 CCCCTGCATCCCCCACATAGTGG - Intergenic
1034224060 7:149469186-149469208 CTCCAGTGTGCCCCAAATGAAGG - Intergenic
1035616954 8:1009058-1009080 CTCCTGCCTGCCCCCCATCAGGG - Intergenic
1036639063 8:10570825-10570847 CTCTTGACTGCCCCACCTGGGGG + Intergenic
1040769049 8:50950793-50950815 GACATGCGTGCCCCACAGGGTGG + Intergenic
1041153962 8:54964454-54964476 CTCCTGTGTGCCCCACACCATGG + Intergenic
1041271476 8:56113493-56113515 CCCCTGCGTCCCCCTCAGGGTGG + Exonic
1041713443 8:60913337-60913359 CTCCTATGTGCCCCAGATGCAGG + Intergenic
1041936202 8:63334749-63334771 CCCCTGCAGGCCCCAGATGGAGG - Intergenic
1042649446 8:71023777-71023799 TTCCTGCATGCATCACATGGGGG - Intergenic
1043136402 8:76531715-76531737 TTCCTGCGTGCTGCTCATGGTGG - Intergenic
1047108121 8:121757858-121757880 ATCCTGCTTTCCCCACAAGGAGG + Intergenic
1048338598 8:133521635-133521657 CTCCTGCATGCTCCACATTAAGG + Intronic
1051963625 9:22799323-22799345 ATTCTGGGTGCCACACATGGGGG + Intergenic
1056072039 9:82997452-82997474 CTCCTCTGTGTCCCACATGTGGG - Intronic
1056346958 9:85706476-85706498 CTCCAGCCTGGGCCACATGGTGG + Intronic
1056874167 9:90311973-90311995 CTCCTGCCTTCCCCGGATGGAGG - Intergenic
1057354010 9:94320637-94320659 CTCCTGCCTGCACCACACAGGGG + Intronic
1057653755 9:96936998-96937020 CTCCTGCCTGCACCACACAGGGG - Intronic
1060804095 9:126564043-126564065 CTGCTGCGTGCCCCACATCCTGG - Intergenic
1061138458 9:128750407-128750429 CTCCTCCCTGCCCCATGTGGGGG - Intronic
1062049478 9:134439604-134439626 CTCCTGGGTGCCCCACGGGGAGG - Intronic
1062212820 9:135373756-135373778 CTCCTGCGTCCCGTGCATGGGGG - Intergenic
1188309264 X:28597170-28597192 CTCCTGCTTGCCAGACATGAAGG - Intronic
1192684526 X:73289383-73289405 CTTCTCTGTGCCCCACAAGGAGG - Intergenic
1194711915 X:97245698-97245720 CTCATGTAGGCCCCACATGGGGG - Intronic
1198416774 X:136428329-136428351 GTCCTGCCTGGCCTACATGGCGG + Intergenic