ID: 1179980288

View in Genome Browser
Species Human (GRCh38)
Location 21:44891981-44892003
Sequence TCACCTGGAAGGTGATCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179980279_1179980288 25 Left 1179980279 21:44891933-44891955 CCCGGATGACAAACGACTGCTCC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG 0: 1
1: 0
2: 0
3: 27
4: 183
1179980283_1179980288 4 Left 1179980283 21:44891954-44891976 CCTGGATGCACTCTGTGGCCGTG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG 0: 1
1: 0
2: 0
3: 27
4: 183
1179980280_1179980288 24 Left 1179980280 21:44891934-44891956 CCGGATGACAAACGACTGCTCCT 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG 0: 1
1: 0
2: 0
3: 27
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179980288 Original CRISPR TCACCTGGAAGGTGATCTGC AGG Exonic
901401834 1:9019995-9020017 TCACCAGGAAACAGATCTGCTGG + Intronic
901598081 1:10400512-10400534 TCACCAGGAGGATGATCCGCCGG - Exonic
902115155 1:14115134-14115156 TCACCAGGAAGTGAATCTGCAGG - Intergenic
903370004 1:22829364-22829386 TAAGCTGGAAGCTGATCTGGTGG - Intronic
905208192 1:36355014-36355036 TCACCAGGAAGGTGGCCTGCAGG + Intronic
905544344 1:38785940-38785962 CCACCTGGAAGCTGACATGCTGG - Intergenic
906323331 1:44829730-44829752 TCAGCAAGAAGGTGCTCTGCAGG + Exonic
907795089 1:57708213-57708235 TGAGCTGGAAGGGAATCTGCTGG - Intronic
917040144 1:170796612-170796634 TCACACGGAAGATGCTCTGCTGG + Intergenic
919169041 1:193930762-193930784 AAACCAGGAAGCTGATCTGCTGG + Intergenic
920031439 1:203039667-203039689 TCACATGGAAGATGATAGGCAGG + Intronic
920052420 1:203171948-203171970 CCACCTGGAAGGGGATTTGCAGG + Exonic
920054220 1:203180971-203180993 GCTCTGGGAAGGTGATCTGCAGG - Intronic
921252718 1:213312437-213312459 GCACCTGGAAGGGGATTTTCAGG + Intergenic
922413457 1:225397629-225397651 TCACCTGGAATTGGAGCTGCAGG + Intronic
923026622 1:230209481-230209503 TCACCAGGAACCAGATCTGCTGG + Intronic
1063467073 10:6253739-6253761 TCTTCAGGAAGGTGATATGCTGG + Intergenic
1067428106 10:46224429-46224451 GCAGCTGGAAGGTGAAATGCAGG - Intergenic
1067661955 10:48242765-48242787 TCCCCTGGAATGTGAGCTCCTGG + Intronic
1068531285 10:58189562-58189584 TCAGCTGGCAGGTCATCTGGGGG - Intergenic
1070086184 10:73239363-73239385 CGACCTGGCAGGGGATCTGCAGG + Exonic
1074001410 10:109377307-109377329 GCACCTTGAAGGTGATATGTTGG + Intergenic
1080769810 11:35330242-35330264 TTACCTGGAAGGTTGTGTGCAGG - Intronic
1081604568 11:44519376-44519398 TCACCAGGAACATAATCTGCCGG - Intergenic
1081679777 11:44994160-44994182 CCACCTGGAAGGTGAGCTGAGGG - Intergenic
1082080370 11:48008094-48008116 ACACGTGCCAGGTGATCTGCTGG + Intronic
1083551302 11:63592044-63592066 TCAGCTGGTTGGTGATGTGCTGG - Intronic
1084065547 11:66701820-66701842 TCACCAGGAGGCTTATCTGCAGG + Intronic
1085283368 11:75345031-75345053 GCACCTGGAGAGGGATCTGCTGG - Intronic
1088141518 11:106622493-106622515 TCACCTGGAAGCAGAATTGCAGG + Intergenic
1089286212 11:117409673-117409695 TCAGCTGGCTGCTGATCTGCCGG - Exonic
1089596373 11:119583559-119583581 GGACCTGGGAGGTGAGCTGCAGG + Intergenic
1090187724 11:124749195-124749217 ATACCAGGAAGGTGATCTGGGGG + Intronic
1092290938 12:7159102-7159124 TCACCTGGAAAGTAAGCTGGGGG + Intergenic
1099270150 12:80498514-80498536 CCAGCTGGAAAGTGATCAGCTGG + Intronic
1099270151 12:80498529-80498551 TCAGCTGGAAAGTGATGAGCTGG + Intronic
1101452494 12:104792634-104792656 TCACAGGGAAGGTGACCTGAAGG - Intergenic
1104091234 12:125519511-125519533 CCACCTGCCAGGTAATCTGCTGG - Exonic
1105668623 13:22588153-22588175 TAACCGGCAAGGTGATCTGAGGG - Intergenic
1106826897 13:33532902-33532924 TCACCTGGAAGGTGCCCATCTGG - Intergenic
1110358423 13:74595878-74595900 TTACCTGAAAGGTGATCTGGAGG + Intergenic
1112610542 13:100950813-100950835 TCACCTGGCAGGTAATCAGCAGG + Intergenic
1113474091 13:110567683-110567705 CCACCTGGGACGCGATCTGCCGG - Intergenic
1118284843 14:64461932-64461954 TCACCTGGAATGGGATTTGCTGG + Intronic
1118931653 14:70247508-70247530 TCCCCTTGAAGGTGATCAGCAGG - Intergenic
1118953511 14:70457630-70457652 TCCCCTTGAAGGTGATCAGCAGG + Exonic
1118960376 14:70524605-70524627 TCCCTTTGAAGGTGATCAGCAGG - Exonic
1119217572 14:72880837-72880859 CCAGCTGGAAAGTGTTCTGCTGG + Intronic
1119779544 14:77269156-77269178 CCACCAGGGAGGTGCTCTGCTGG + Intronic
1119992441 14:79214236-79214258 TCACCTGGAAGGTTTTCCTCTGG + Intronic
1121520429 14:94582531-94582553 TCACCTGGCAAGTGAGCTCCGGG + Intronic
1121740296 14:96247173-96247195 GCTCTGGGAAGGTGATCTGCAGG - Intronic
1121835034 14:97084793-97084815 TCACCAGGAACTGGATCTGCTGG - Intergenic
1122636085 14:103130308-103130330 GGGCCTGGGAGGTGATCTGCAGG - Exonic
1122907914 14:104810680-104810702 TCCCCTGGAATGTGAGCTTCAGG + Intergenic
1125569976 15:40709106-40709128 TCACCTGCCAGGTGAGCTGTTGG + Exonic
1128106690 15:65050576-65050598 TCATCAGGAAGGTGACTTGCAGG + Intronic
1128617847 15:69124147-69124169 TGCCCTGGAAGGTAATCTCCAGG - Intergenic
1128883274 15:71262807-71262829 ACACGTGGAAGGTGAACAGCAGG - Intronic
1131827857 15:96334338-96334360 CCACCTGGTCCGTGATCTGCAGG - Exonic
1132191803 15:99868843-99868865 TCTCCAGGAAGGAGATCTTCAGG - Intergenic
1132387418 15:101410292-101410314 TCACCTTGGAGGTGAGCTGATGG + Intronic
1134063091 16:11210749-11210771 TCACCTGCAAGGTGGTGTGAGGG - Intergenic
1134213582 16:12298343-12298365 TCCCCTGGATGGTTTTCTGCAGG + Intronic
1135721645 16:24822915-24822937 TCAGGTGGAATGTGATCAGCGGG - Exonic
1135970348 16:27067538-27067560 TCACCTACAAGGTGAGCAGCGGG + Intergenic
1137345363 16:47653046-47653068 TCACTTATAAGGTGATCTGATGG + Intronic
1139397800 16:66654376-66654398 TCACATGGCAGGTGCTCTCCAGG + Intronic
1140653135 16:77110206-77110228 TAACTTGGAAGATGATCTGTGGG + Intergenic
1140794548 16:78424936-78424958 TCACTTGAAAGGTGGTCTCCAGG - Exonic
1141880582 16:86856368-86856390 CCACCTGGAAGGTGAGTTCCAGG - Intergenic
1143023563 17:3928765-3928787 TCACCTGGAAAATGAGCTGGCGG + Exonic
1146827269 17:36033545-36033567 ACACCTGGCAGGTGCTCTGACGG + Intergenic
1147050229 17:37788895-37788917 TCCCCTGGAAGGTGAGGTGCAGG + Intergenic
1148532572 17:48408850-48408872 TCACAGTGAATGTGATCTGCAGG + Intronic
1149274320 17:55016727-55016749 TCCCCTGTAAGGAAATCTGCTGG + Intronic
1150026344 17:61678565-61678587 TTACCAATAAGGTGATCTGCTGG + Intergenic
1151746613 17:76015001-76015023 ACTCCTGGAAGTTGTTCTGCAGG + Exonic
1152743058 17:82026924-82026946 TCTCCTGGAAGGTGGTGAGCCGG - Exonic
1155956954 18:31962381-31962403 TCACCAGGAGGATGATCCGCTGG - Intergenic
1157576813 18:48749171-48749193 TGACCTGGAAGTTGCTCTCCCGG - Intronic
1159112361 18:64074056-64074078 GCTACTGGAAGGTGATCTTCAGG - Intergenic
1161777343 19:6270744-6270766 TCACCTGGACGGTGCACTGGAGG + Exonic
1163691421 19:18740593-18740615 GCTCCTGGGAGGTGACCTGCAGG - Intronic
1163783093 19:19260801-19260823 GGACCTGGAAGGTGATCAGCCGG - Exonic
1164719492 19:30422090-30422112 GCATCAGGAAGGTGATATGCGGG + Intronic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1167552957 19:50173669-50173691 TCACCAAGAAGGTGATATTCAGG + Intergenic
925134551 2:1516958-1516980 TCACCTCGACGGTGATTTGCAGG + Exonic
925731610 2:6922963-6922985 TCACCTGGCTGGTGATCTGGTGG + Intronic
927753527 2:25690517-25690539 TCAGCTGGAAGGTCCTCTGCTGG - Intergenic
928092171 2:28381716-28381738 GCACCTGGAAGCAGGTCTGCAGG - Intergenic
934574333 2:95390808-95390830 TCACAGGGAAGGGGATCTGAGGG + Intergenic
935664189 2:105495871-105495893 TCAAATGTCAGGTGATCTGCTGG + Intergenic
937086503 2:119175253-119175275 CCCTCTGGGAGGTGATCTGCAGG - Intergenic
937640904 2:124209906-124209928 GCAAGTGGAAGGTGATGTGCGGG + Intronic
938822882 2:134976658-134976680 TCACCTGGAAAATGATCTGGTGG - Intronic
941719501 2:168798493-168798515 TGGCCTGGAAGCTGCTCTGCTGG - Intronic
942701405 2:178715184-178715206 TCACCTTGAATGTGAGCTTCAGG - Exonic
943707537 2:191051199-191051221 TCACCTGTCAAGTGCTCTGCTGG - Intronic
946846936 2:223867772-223867794 TCAACTGGAAGCTAATATGCTGG - Intronic
947851817 2:233294418-233294440 TGTCCTGGCAGGTGATGTGCTGG + Exonic
947857779 2:233335886-233335908 TCACCTCGGAGGTGGTCTACTGG - Intronic
948535192 2:238640688-238640710 GCATCTGGAAGGTGATCCGAGGG - Intergenic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
1170313777 20:15020228-15020250 TCACCTGAAAGGTCATCTTAAGG + Intronic
1170645211 20:18191619-18191641 GCACCTGGAACCTGCTCTGCTGG - Intergenic
1172127908 20:32636130-32636152 TTGCCTGGATGGTGAGCTGCTGG + Intergenic
1172736957 20:37133812-37133834 CCACCTGGAAAGTGATGTGATGG - Intronic
1173316601 20:41950412-41950434 CCTCCTGGAAGGTGGGCTGCAGG - Intergenic
1173823571 20:46033298-46033320 TCACTTGGAATTTGATCAGCGGG + Intronic
1179175805 21:39007107-39007129 TTAGCTGGAAGGAGCTCTGCAGG - Intergenic
1179267290 21:39814959-39814981 TCACCAGGAATGGGATTTGCTGG + Intergenic
1179479923 21:41670509-41670531 TAACCTGGCAGATGACCTGCTGG - Intergenic
1179980288 21:44891981-44892003 TCACCTGGAAGGTGATCTGCAGG + Exonic
1181415659 22:22756895-22756917 GCACCTGCAGGGTGAGCTGCAGG + Intronic
1183545107 22:38451251-38451273 TCACCTGGCAGGTGCTCATCTGG + Intronic
949607566 3:5671193-5671215 TCACCAGGAACGAAATCTGCTGG + Intergenic
950252047 3:11474104-11474126 CCACCTGGCAGGTGATTTGCAGG + Intronic
950678943 3:14571646-14571668 TCACCTGGCAGGGGAGCTGGAGG + Intergenic
952718275 3:36504508-36504530 CCACTTGGATGGTGACCTGCAGG - Intronic
955913137 3:63878936-63878958 TCACCTGGAAGCTGGCCAGCAGG + Intronic
959246967 3:103882799-103882821 GAACCTGGAAGGTGATATGAAGG - Intergenic
959619944 3:108389047-108389069 TGAACTGGAAGGTGAACTGGAGG - Exonic
962018927 3:131476053-131476075 TCACCTGGCATGTGTTCTACTGG - Intronic
963915543 3:150855989-150856011 TCACCTGTAAGGAAATCTGCTGG - Intergenic
964435272 3:156644511-156644533 TCACCTGAAAGGCGGTCTGGAGG - Intergenic
964939311 3:162135778-162135800 TCACCGGGAAGGTGACCAGATGG - Intergenic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
967368284 3:188713024-188713046 TCATCTGTGAGGTGATCTTCTGG - Intronic
968883300 4:3312701-3312723 TGACCAGGAAGCTGATCTCCGGG + Intronic
969114744 4:4864525-4864547 TCGCCTGGAAAGTCCTCTGCAGG + Intergenic
969285906 4:6201560-6201582 TCACCTGGAAGGTGGTCCCATGG + Intergenic
971332830 4:25696444-25696466 CTACCTGCCAGGTGATCTGCAGG - Intergenic
974660638 4:64883803-64883825 TCACCATGAAGGGGACCTGCAGG - Intergenic
979711480 4:123785123-123785145 CCACCTGGAAAGTGATGTGATGG - Intergenic
979974205 4:127176085-127176107 TTACCTGGGAGGTGATCTCCAGG + Intergenic
980408753 4:132387062-132387084 TCACCTAGAAGGAGATCTTCAGG + Intergenic
984187219 4:176560709-176560731 TGATATGGAAGGTGCTCTGCCGG + Intergenic
985420496 4:189780717-189780739 TCAACTGGAAGACGATCTGTGGG - Intergenic
986300186 5:6472291-6472313 TCACCTGCAAGTGGATCTTCTGG + Intronic
986448891 5:7847682-7847704 TCACTTGGAAGGAGGTCCGCTGG - Intronic
986817128 5:11425259-11425281 CCACCTGGTAGATGATTTGCAGG + Intronic
987299878 5:16587896-16587918 TCACCTGGAAAGGGATTGGCTGG - Intronic
995465417 5:112445702-112445724 TCACCTGTTAGGAAATCTGCTGG - Intergenic
996331263 5:122331622-122331644 TCACCTGACATGAGATCTGCTGG - Intronic
998985055 5:147747607-147747629 GCACCTGGAAGATGGTCTGCGGG - Intronic
1002891011 6:1331916-1331938 TTACCTGGAATTTGATCTACAGG + Intergenic
1003429493 6:6025908-6025930 TCAGCTCAAAGGTGAACTGCGGG - Intergenic
1005806246 6:29476624-29476646 TCACCTGGAAGGTGACCCTGAGG - Intergenic
1007097921 6:39225695-39225717 TCAGCTGGACCCTGATCTGCTGG - Intronic
1007354821 6:41306516-41306538 TTACCTGGGAGGAGATCTGCGGG + Intergenic
1007952749 6:45886614-45886636 TCACCTGAAAGGAAATCTGAAGG + Intergenic
1009298605 6:61986694-61986716 TCACCAGGAACGGAATCTGCCGG - Intronic
1012313869 6:97761057-97761079 TCAGGTGGAATGTGAACTGCTGG - Intergenic
1013022011 6:106229989-106230011 TCCCCTGTAAGGAAATCTGCAGG - Intronic
1013840775 6:114390672-114390694 TGACCTGGAGGGTGATCAGAAGG - Intergenic
1016337673 6:143025280-143025302 TCACCTGGTAGCAAATCTGCTGG - Intergenic
1017413248 6:154192122-154192144 ACACCTGGAAGTGGAACTGCTGG + Intronic
1017545783 6:155449702-155449724 TCCCCTGTAAGCTGAACTGCAGG - Intronic
1019100683 6:169626607-169626629 TGACCTGGAAGGTGATCCTGAGG + Intronic
1019442493 7:1054533-1054555 TCACGTGGAGTGGGATCTGCTGG - Intronic
1019929941 7:4216676-4216698 TCACCTGGTAGGGGATCTGTGGG + Intronic
1019989694 7:4682752-4682774 GCTCCTGGAAGCTGAGCTGCAGG - Exonic
1022038653 7:26558412-26558434 CCATCTGGAAGGTCCTCTGCAGG + Intergenic
1023029102 7:36077632-36077654 TCTCCTGGAGGCCGATCTGCTGG - Intergenic
1028001394 7:85502229-85502251 TCACCTGTAAGGTGAGCCCCAGG + Intergenic
1029493933 7:100887190-100887212 TCACGGGGAAGGTGAGCTCCAGG + Exonic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1029601565 7:101566568-101566590 TCACCAGGAACCGGATCTGCTGG - Intergenic
1031680611 7:124669112-124669134 ACACCAGGAAGGTAATATGCTGG + Intergenic
1033283790 7:140023916-140023938 CCACCTGGCAGGTGACCTGGAGG - Exonic
1034488367 7:151380302-151380324 TCACCTGCTAGGTGATGGGCGGG - Intronic
1035529038 8:336915-336937 TCACCTGTGAGGTGAACGGCAGG - Intergenic
1038333369 8:26627327-26627349 TCACCTGGAGGGTGAGAGGCAGG + Intronic
1040750814 8:50704593-50704615 TCACCAGGACAGTGACCTGCTGG + Exonic
1045206102 8:100042699-100042721 GAACCTGCAAGGTAATCTGCTGG - Intronic
1045816635 8:106284167-106284189 CTACCTGGAAGGTGCTCTGAAGG + Intronic
1047838606 8:128721596-128721618 TCTGCTGGAAGGTCAGCTGCTGG + Intergenic
1048052450 8:130830734-130830756 GCACCTTGTAGGTGATGTGCTGG - Intronic
1049259055 8:141629170-141629192 TCACCTGGCAGGCAGTCTGCTGG + Intergenic
1049333176 8:142066056-142066078 TCACCTGGAGAATGATCTTCTGG - Intergenic
1049410451 8:142471687-142471709 TCACCTGGGAAGTGGCCTGCCGG + Intronic
1049768476 8:144367162-144367184 TGACCAGGAAGGTGATTTCCTGG + Intergenic
1050153960 9:2645789-2645811 TCACTTGGGAAGTGATCTGTGGG + Intronic
1050397647 9:5216219-5216241 TCACCTGGAATCTGATCAGAGGG + Intergenic
1051911439 9:22156613-22156635 TCACCTGGCAGGTAATCGGAGGG - Intergenic
1056206140 9:84321160-84321182 TCTACTGGAAGGTGTTGTGCTGG - Intronic
1057242119 9:93420320-93420342 TCTCTTGGAAGGTGGGCTGCAGG + Intergenic
1061858621 9:133456570-133456592 TCACCTGGAGGAAGATGTGCAGG + Exonic
1062409987 9:136418734-136418756 TCACCTGGAAGGTGGCCTCATGG - Intronic
1062681374 9:137783619-137783641 TCAGCTGTAGGGTGATCTGCAGG + Intronic
1185927066 X:4158883-4158905 CCCCCTGAAAGGTGATCTCCTGG - Intergenic
1186254275 X:7702120-7702142 TCCCCTGTAAGGAAATCTGCTGG + Intergenic
1186801397 X:13096042-13096064 TCATATGGAAGTTGAGCTGCAGG - Intergenic
1187246821 X:17560307-17560329 CCAACTGGAAGGAGATCTTCAGG + Intronic
1189195540 X:39149121-39149143 TCACCTCCATGGTGATCTGAAGG - Intergenic
1190252358 X:48736853-48736875 TCACCTTGAATCTTATCTGCTGG + Intergenic
1190629623 X:52372548-52372570 TGACCTGGAAGCCGATCTCCAGG + Exonic
1190630956 X:52385494-52385516 TGACCTGGAAGCTGATCTCAAGG + Intergenic
1190637315 X:52448686-52448708 TGACCTGGAAGCTGATCTCCAGG - Intergenic
1190648718 X:52547574-52547596 TGACCTGGAAGCTGATCTCCAGG + Intergenic
1190679739 X:52815096-52815118 TAACCTGGAAGCTGATCTCCAGG + Exonic
1190684986 X:52864874-52864896 TGACCTGGAAGCTGATCTCCAGG - Exonic
1190954231 X:55175905-55175927 TGACCTGGAAGCTGATCTCCAGG + Intronic
1190998216 X:55633130-55633152 TGACCTGGAAACTGATCTCCAGG - Intergenic
1191000438 X:55654808-55654830 TGACCTGGAAACTGATCTCCAGG - Intergenic
1195105663 X:101599852-101599874 CCACCTGGAAGGCAAGCTGCGGG - Intergenic
1195107220 X:101613915-101613937 CCACCTGGAAGGCAAGCTGCGGG + Intergenic
1200116593 X:153772269-153772291 TGACCTGGTAGGTGAAGTGCTGG - Exonic
1201246302 Y:12007206-12007228 TCACCTGATAGGAGCTCTGCAGG + Intergenic