ID: 1179983181

View in Genome Browser
Species Human (GRCh38)
Location 21:44907030-44907052
Sequence CCTCATGAGCAGCTGTGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179983174_1179983181 2 Left 1179983174 21:44907005-44907027 CCATGATGTCGTCAGCCGCACAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG 0: 1
1: 0
2: 1
3: 23
4: 321
1179983170_1179983181 29 Left 1179983170 21:44906978-44907000 CCTGGGTTTCAGCGAGGCTTGTG 0: 1
1: 0
2: 2
3: 98
4: 2121
Right 1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG 0: 1
1: 0
2: 1
3: 23
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179983181 Original CRISPR CCTCATGAGCAGCTGTGGCC GGG Exonic
900146162 1:1159685-1159707 CCACCTGGGCAGCTGTGTCCTGG - Intergenic
900186559 1:1335812-1335834 CCTCCTGCACAGCTGTGCCCAGG - Exonic
900987169 1:6079947-6079969 CTTCATGAGCAGGTGTGGATTGG + Intronic
901921872 1:12542416-12542438 CCTGATGAGCACTTGTGGACTGG + Intergenic
902375719 1:16029115-16029137 CTTCATGGACAGCTGTGGCGGGG - Exonic
902380670 1:16050864-16050886 CTTCATGGACAGCTGTGGCGGGG - Exonic
902792534 1:18778819-18778841 CTTCCTGAGCTGCTGGGGCCAGG + Intergenic
903177643 1:21590294-21590316 CCGCCTGAGGGGCTGTGGCCTGG + Intergenic
905634105 1:39537819-39537841 CCTCTCGAGTAGCTGTGACCAGG + Intergenic
907049179 1:51318192-51318214 CCGGCTGAGCAGCTGTGTCCTGG + Intronic
907491753 1:54813031-54813053 CCCCATGACCAGCTATGGCAGGG + Intronic
908565868 1:65355519-65355541 TCTGTTGAGCAGCTGTGTCCAGG + Intronic
909466575 1:75980128-75980150 CCTCATCAGCAGCTGCTGCTTGG - Intergenic
911583304 1:99660193-99660215 CCTCATGAAGTACTGTGGCCAGG - Intronic
913024963 1:114828956-114828978 TCTCCTGAGTAGCTGTGACCAGG + Intergenic
913233391 1:116760699-116760721 CAGCATGAGCACCTGTGACCTGG - Intronic
914420845 1:147527147-147527169 CCTCACGAGGTGCTGTGGCTGGG - Intergenic
915313702 1:155016945-155016967 CCCCAGGAGCAGCTGGGGACAGG - Exonic
915466459 1:156101368-156101390 CCTCCTGAGTAGCTGGGACCAGG - Intronic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
918613032 1:186513501-186513523 CTTCAGGATCAGCTGTGGGCTGG + Intergenic
919754944 1:201060900-201060922 AGTCAGGAGCAGCTGTGGCCAGG + Intronic
920130119 1:203725683-203725705 CCTCATCCTCAGCTCTGGCCTGG + Intronic
920943006 1:210501628-210501650 CCCCAGGAGCAGCTGGGGACAGG - Intronic
922350901 1:224733901-224733923 CCTCCTCAGGGGCTGTGGCCAGG + Intronic
922487895 1:225989951-225989973 CCTCCTGAGTAGCTGGGGCTAGG - Intronic
922917385 1:229270303-229270325 CCTCCTGAGTAGCTGGGGCTAGG - Intergenic
922926102 1:229347752-229347774 TCACATGCGCAGCTGTTGCCAGG - Intergenic
1064328625 10:14373641-14373663 CCTGTTGAGCTGCAGTGGCCAGG - Intronic
1065255270 10:23860146-23860168 CCTCATGAGCAGCTCTGGGCAGG + Intronic
1065983999 10:30931079-30931101 CCTCATGTGTCACTGTGGCCTGG - Intronic
1066514524 10:36142378-36142400 TCTCTTGAGCTGCTGTGGCTTGG + Intergenic
1067062735 10:43086276-43086298 CCTCATGAGCAGGTCTGCTCCGG - Intronic
1067286632 10:44912027-44912049 AGTCATGAGCAGCTCTGCCCTGG + Intronic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1067692048 10:48508297-48508319 CCTCATGACCAGCTGTTACTGGG + Intronic
1068633221 10:59320005-59320027 CCCCAGGAGCAGCAGTTGCCAGG + Intronic
1069718892 10:70537895-70537917 CTTCATGAGCAGGTGGGGCCTGG + Exonic
1072267315 10:93743162-93743184 CCTCCTGAGTAGCTGGGACCAGG - Intergenic
1073063131 10:100744043-100744065 CCTCAGGAGGAGCTCAGGCCAGG - Intronic
1074827119 10:117222723-117222745 CATCAAGAGCAGCTGGGGCAGGG - Intergenic
1075414104 10:122249751-122249773 CTTCAGGAGCAGCAGTGGCCAGG - Intronic
1075680715 10:124329271-124329293 CCACATGAGCAATAGTGGCCAGG + Intergenic
1075963106 10:126586316-126586338 GCTCCCCAGCAGCTGTGGCCTGG + Intronic
1076016906 10:127034999-127035021 TCTCAGCAGCAGCTGTTGCCAGG + Intronic
1076380441 10:130021457-130021479 CCCCAGGGGCATCTGTGGCCTGG + Intergenic
1076745682 10:132512423-132512445 CCTCTTGCCCACCTGTGGCCAGG + Intergenic
1076769816 10:132656790-132656812 CCACCTGAGCAGCTGTGGAAGGG - Intronic
1077243003 11:1521017-1521039 CGTCAGAAGCAGCTGGGGCCAGG + Intergenic
1077244764 11:1531151-1531173 CCTCCTGAGCAGCTCTGCTCTGG - Intergenic
1077252920 11:1568545-1568567 CCGCAGGAGCAGCGGTTGCCTGG - Intronic
1077587500 11:3465013-3465035 CCTCCTGAGTAGCTGAGACCGGG + Intergenic
1078956963 11:16209629-16209651 CCTCCTGAGTAGCTGGGGACAGG - Intronic
1079022665 11:16922736-16922758 CCTCAGTAGCAGCTGTGGCAGGG - Intronic
1079396680 11:20069561-20069583 CCTGATGCACAGCTGTGACCAGG + Intronic
1080474946 11:32581729-32581751 CCTGATGATCTGCTGTGGGCTGG + Intergenic
1080875977 11:36274585-36274607 ACTCATGAGCAGCTGGGTCATGG + Exonic
1084422662 11:69068126-69068148 GCTCAGGTGCAGGTGTGGCCAGG + Intronic
1084670370 11:70603278-70603300 CCCCATGAGCAGTTGTGGGCAGG + Intronic
1084674078 11:70624146-70624168 CCTCAGGAGGGGCTGAGGCCGGG + Intronic
1086764099 11:90673572-90673594 GCACATGAGCAGATGTGGCAGGG - Intergenic
1088535855 11:110860203-110860225 CGTCATGGGCAGATGTGGGCTGG + Intergenic
1088705998 11:112465295-112465317 TCTTATGTGAAGCTGTGGCCTGG + Intergenic
1089743109 11:120598655-120598677 CCTCAGTATCAGCTGTGGCAAGG + Intronic
1089758706 11:120707098-120707120 CCTCCTGAGCAGCCCTGTCCTGG - Intronic
1090328975 11:125914856-125914878 CCTCAAGAGTAGCTGTAGCTGGG + Intronic
1091693704 12:2613799-2613821 CAGCATGACCAGCTGAGGCCAGG + Intronic
1091831012 12:3551263-3551285 CCTCAGGTGCAGCTTTGACCAGG + Intronic
1091855133 12:3733181-3733203 CCTGAAGGGCAGCTGTGGTCAGG + Exonic
1092111025 12:5964997-5965019 CATCGTGTGCAGCTGTGGTCTGG - Intronic
1092593260 12:9971120-9971142 ACTAATCTGCAGCTGTGGCCTGG - Intronic
1092744381 12:11659867-11659889 CCTCACTTGCAGGTGTGGCCTGG + Intronic
1092938872 12:13389210-13389232 CCTTATGAGCATCTAGGGCCAGG + Intergenic
1095943465 12:47740662-47740684 CTTCCTGAGCAGCTGGGCCCGGG + Exonic
1095981501 12:47977111-47977133 CCTCAGGACCAGCTGGAGCCCGG - Exonic
1098341480 12:69456031-69456053 CCTCCTGAGTAGCTGGGACCAGG + Intergenic
1101590824 12:106123778-106123800 TCTCTTTGGCAGCTGTGGCCTGG - Intronic
1102012184 12:109625613-109625635 CCTCAGGGGCAGCAGTGGCAGGG + Intergenic
1103548614 12:121719814-121719836 CCTCCTGAGTAGCTGTAGCTAGG + Intronic
1105698051 13:22910005-22910027 CCTAAAGAGCAGGTGAGGCCGGG - Intergenic
1106237782 13:27879373-27879395 CCTCCTGAGTAGCTGGGACCAGG - Intergenic
1110867291 13:80409536-80409558 CCTCCTGAGTAGCTGGGACCTGG + Intergenic
1111929950 13:94502816-94502838 CTGCATGAGCAGATGTGGTCTGG - Intergenic
1112331184 13:98478111-98478133 CCTCATGAGCAGCTCGGACCAGG + Intronic
1112344348 13:98577284-98577306 CCGCAGGAGCAGCTGGGACCCGG - Intronic
1113780622 13:112974755-112974777 TTTCATGAGCAGCTGAAGCCTGG - Intronic
1114244228 14:20897735-20897757 TCTCATTATTAGCTGTGGCCTGG - Intergenic
1114493794 14:23119114-23119136 CCTCAAGAGCAGGTGGGGGCGGG - Exonic
1115196725 14:30808548-30808570 CTTCATTAGTAGCTGTGTCCTGG - Intergenic
1115871219 14:37804912-37804934 CTTCATAAGCAGCTTTGGACCGG - Intronic
1115883415 14:37945634-37945656 CCGTATAAGCAGGTGTGGCCAGG - Intronic
1115997815 14:39211980-39212002 TCTCTTGTGCATCTGTGGCCTGG + Intergenic
1118320563 14:64749870-64749892 CCTGAGGAGCAGCTCAGGCCTGG + Exonic
1119399522 14:74352993-74353015 CCTAAAGAGCATCTGGGGCCAGG + Intronic
1121056313 14:90856998-90857020 CATCTTGAGCACCTGTGGCTTGG - Exonic
1121986044 14:98506891-98506913 CCTCCTGAGCAGCACTGGGCTGG + Intergenic
1122013028 14:98769389-98769411 CCTCCTTAGCATCTATGGCCAGG - Intergenic
1122123302 14:99566010-99566032 CCTCATGGTCAGCGGTGCCCAGG - Intronic
1122392050 14:101396337-101396359 CCCCTGGAGCAGCTCTGGCCAGG + Intergenic
1122548754 14:102538968-102538990 CCCCAATAGCAGCTGGGGCCAGG - Intergenic
1124160160 15:27260838-27260860 CCTAATGAGCTGATGTGGTCGGG + Intronic
1124203986 15:27701877-27701899 GCTCTTCAGCAGCTGTGGGCAGG + Intergenic
1125650285 15:41311687-41311709 CCTCCTGAGTAGCTGGGGCTGGG + Intronic
1125721830 15:41848913-41848935 CCTCAGGAGCCACTGTGTCCAGG + Intronic
1125922973 15:43537221-43537243 CCTCCTGAGTAGCTGTAGCTGGG - Intronic
1126225124 15:46261606-46261628 CCCCATAAGCAGGTGTGGCCAGG + Intergenic
1126589349 15:50323748-50323770 CCTCCTGAGTAGCTGTAGCTGGG - Intronic
1127997372 15:64161372-64161394 CCTCCTGAGTAGCTGTAGCTGGG + Intronic
1128074899 15:64819937-64819959 CCTTGTGGGAAGCTGTGGCCTGG + Exonic
1128088990 15:64906172-64906194 CCTCACCTTCAGCTGTGGCCTGG + Intronic
1128704669 15:69830198-69830220 CCTCATGAGGAGCTCTGCTCTGG - Intergenic
1129164489 15:73768551-73768573 TCTCAGGAGCAGCTGGGGGCTGG + Intergenic
1129319028 15:74763553-74763575 GCGCATGGGCAGATGTGGCCTGG + Intergenic
1129377482 15:75143234-75143256 CCTTATGGGCAGTTGGGGCCTGG + Intergenic
1131456927 15:92588863-92588885 CCTCACCAGCTGCTGTGGTCAGG + Intergenic
1132602800 16:781509-781531 CCTCCTGGGCTGCTGGGGCCCGG + Intronic
1133315367 16:4880303-4880325 CCTCCTGAGCAGCAAGGGCCCGG - Exonic
1133552699 16:6872950-6872972 ACTCAAGACCAGCTGCGGCCGGG - Intronic
1135378653 16:21973955-21973977 CATCTCCAGCAGCTGTGGCCTGG - Exonic
1137552524 16:49449356-49449378 CCTCCTGAGTAGCTGGGGCAAGG - Intergenic
1141161101 16:81629665-81629687 CCATTTTAGCAGCTGTGGCCAGG + Intronic
1141219714 16:82058190-82058212 CCTCCTGAGTAGCTGGGGCCAGG + Intronic
1141765557 16:86056655-86056677 GCCCATGAGCAACTGTGGTCTGG + Intergenic
1142418918 16:89958407-89958429 CATCAGGAACATCTGTGGCCTGG - Intronic
1143021169 17:3917878-3917900 CATCACAAGCAGCTGTGTCCTGG - Intergenic
1143067608 17:4262623-4262645 CCTCCTGAGTAGCTGGGACCAGG - Intronic
1143400122 17:6638182-6638204 GCTCAGGAGGAGCTGTGGTCAGG - Intronic
1144124571 17:12190357-12190379 CCTCCCGAGCAGCTGGGACCCGG - Intergenic
1144646828 17:16980867-16980889 CTTCGTGAGAAGATGTGGCCAGG + Intergenic
1144674329 17:17152317-17152339 CTTCATGAGCAGCTTTCTCCAGG + Intronic
1144734765 17:17548946-17548968 CCTGCTGAGGAGATGTGGCCTGG - Intronic
1145743909 17:27298937-27298959 CCTCCTGAGTAGCTGTAGCAGGG - Intronic
1146282318 17:31552668-31552690 CCTCATGATGAGATGTGACCAGG + Intergenic
1150907879 17:69357978-69358000 GCTAATGAGCAAATGTGGCCAGG - Intergenic
1152017709 17:77762537-77762559 CCTCCTGAGTAGCTGGAGCCGGG + Intergenic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1152643714 17:81459453-81459475 ACCCATGAGCAGGTGGGGCCTGG - Intronic
1152741880 17:82022023-82022045 CCTCGTGGGCCTCTGTGGCCTGG - Intronic
1152799737 17:82325289-82325311 CCTCGTGGGAAGCAGTGGCCAGG + Intronic
1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG + Intergenic
1156001899 18:32394604-32394626 CCTCTTGAGAGGATGTGGCCTGG + Intronic
1156444123 18:37222088-37222110 CCTCCAGAGAAGCTGGGGCCTGG + Exonic
1157451119 18:47789949-47789971 GCTCATGAGAGCCTGTGGCCAGG - Intergenic
1157559515 18:48636750-48636772 CCTCAGGAGCCACTGTGGGCCGG - Intronic
1159908459 18:74119869-74119891 TCTGAGGAGCAGCTGTGGCTGGG + Intronic
1160518367 18:79490543-79490565 CCTCCTGAGCACCTGGGGGCAGG + Intronic
1161220972 19:3117994-3118016 CCGCACCAGCAGCTGTGGCCAGG - Intronic
1161347610 19:3776086-3776108 CCTCATGAGCAGCTGCTGGGAGG - Intergenic
1161348210 19:3778320-3778342 CCTCATGAGCAGCTGCTGGGAGG - Exonic
1161446106 19:4320164-4320186 CCTCAGCAGTAGCTGAGGCCTGG + Intronic
1161595933 19:5151030-5151052 GCGGCTGAGCAGCTGTGGCCAGG - Intronic
1161828509 19:6586002-6586024 CCTAATCAGCAGCAGTGGTCAGG + Exonic
1162021912 19:7871983-7872005 CCACAAAAGCGGCTGTGGCCAGG + Exonic
1162876460 19:13624297-13624319 CCCCCTGAGGAGCAGTGGCCTGG - Intergenic
1163191622 19:15680914-15680936 GCACATGAGCAGCTGTGGGTCGG + Intronic
1163354605 19:16801897-16801919 CCTCCTGAGTAGCTGGGGTCAGG - Intronic
1163618512 19:18343608-18343630 CCACATAAACAGCTGTGTCCTGG - Intronic
1164633761 19:29778150-29778172 CTTCAGGATCAGCTGTGCCCAGG + Intergenic
1165144960 19:33724909-33724931 GCTGGTGAGCAGCTGCGGCCTGG - Intronic
1166558251 19:43715930-43715952 CCCCATGAGCAGCTGGGGCTTGG + Intergenic
1166752849 19:45172930-45172952 CGTCCTGAGCATCTGTGGCTGGG - Intronic
1166795843 19:45425160-45425182 CCTCAGGATCAGCTGAGGTCAGG - Intronic
1166862435 19:45818040-45818062 CCTCATGAGCAGCATGGGCAGGG + Exonic
1167493036 19:49802694-49802716 CCTGATGAGCAGCAGAGGCAGGG + Intronic
1167631012 19:50626179-50626201 GGTCATGGGCAGCTGTGGCCAGG - Intronic
1168040111 19:53751749-53751771 CCTCCTGAACAGCTGTCTCCAGG + Intergenic
1168188818 19:54723267-54723289 CATCATGACCAAATGTGGCCTGG - Intergenic
924996309 2:365168-365190 CAACATGAGCGGCTCTGGCCGGG - Intergenic
927087291 2:19685006-19685028 CCTCCTGAGTAGCTGTAGCTGGG + Intergenic
929149321 2:38733497-38733519 CCTCCTGTGCTGCTGAGGCCTGG + Exonic
930805958 2:55490798-55490820 GTTCATGAGCAGCTGTTGCCAGG + Intergenic
930921100 2:56754740-56754762 CCTCACCAGCAGCTGATGCCAGG - Intergenic
932417604 2:71583321-71583343 CCTGAAGAGCACCTGTGGCAGGG - Intronic
933043897 2:77508951-77508973 AGGCATGAGCTGCTGTGGCCTGG - Intronic
935676919 2:105602389-105602411 CCTCCTGAGTAGCTGTAGCTGGG - Intergenic
938086105 2:128403133-128403155 CCTCATCAGCCGCTGGGGCTGGG + Intergenic
938087055 2:128408630-128408652 CCTCAGGAACTGCTGTGCCCTGG - Intergenic
938282077 2:130071587-130071609 CCCCGTAAGCAGGTGTGGCCAGG + Intergenic
938332703 2:130460159-130460181 CCCCGTAAGCAGGTGTGGCCAGG + Exonic
938357104 2:130660512-130660534 CCCCGTAAGCAGGTGTGGCCAGG - Intergenic
938433538 2:131267318-131267340 CCCCGTAAGCAGGTGTGGCCAGG - Intronic
938822664 2:134975356-134975378 CCTCATGAGGACCTGAGGACCGG - Intronic
940849358 2:158673427-158673449 TCTGTGGAGCAGCTGTGGCCGGG - Intronic
941541331 2:166789036-166789058 CCTCCTGAGTAGCTGTGACTAGG - Intergenic
941892356 2:170595558-170595580 CCTCCTGAGTAGCTGGGACCAGG + Intronic
947820252 2:233064128-233064150 CTGCAGGAGCAGCTGGGGCCCGG + Intronic
948032604 2:234831383-234831405 CACCAGGAGCAGCTGTGGCAAGG + Intergenic
948164364 2:235850030-235850052 CCTCCTGAGCAGGTCTGGCCTGG + Intronic
948954176 2:241273778-241273800 CCTCAACAGCACCCGTGGCCTGG - Intronic
949002927 2:241627817-241627839 CCGCATGCCCAGCCGTGGCCTGG + Intronic
1170567763 20:17616442-17616464 GCTCAGGAGCAGCTCTGGGCAGG - Intronic
1171154919 20:22863029-22863051 CCTCAAGAGCTGCCGTGGCCAGG + Intergenic
1171461381 20:25299988-25300010 CAGCATCAGCAGCTGTGGGCTGG - Intronic
1172178459 20:32986567-32986589 CCTCCTGAGGAGCTGGGGCCAGG + Intronic
1173287942 20:41689741-41689763 CCTCCTGAGTAGCTGGGACCTGG - Intergenic
1173331001 20:42076265-42076287 CTTCATGAGCAGCTGGGGTCTGG - Exonic
1174412561 20:50345485-50345507 CCTCTGGATCAGCTGTGGTCAGG - Intergenic
1175364075 20:58439281-58439303 CCTGAAGAGCTTCTGTGGCCTGG + Intronic
1175942930 20:62546210-62546232 TCCCAGGAGCAGCTGTGACCAGG - Intergenic
1176088393 20:63308294-63308316 CCACATTAGCAGCTCTGGCTGGG + Intronic
1176258164 20:64164484-64164506 TCTCATTAGCAGCGGTGGCACGG - Exonic
1176293731 21:5059609-5059631 CCTGTGGAGCAGCTGTGGGCGGG - Intergenic
1176306413 21:5125756-5125778 CCTTCTGAGCAGCTGTGCTCGGG - Intronic
1176369215 21:6052432-6052454 CCCCATGATCAGGGGTGGCCAGG - Intergenic
1176708883 21:10133796-10133818 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1178896845 21:36565812-36565834 GATCTTGAGCAGCTGTGGCAAGG - Intronic
1178931438 21:36822031-36822053 GCTCATTAGCAGCTGTGGGAGGG - Intronic
1179097236 21:38326833-38326855 CCTCATAAGCAACTGTGGACAGG + Intergenic
1179754304 21:43486109-43486131 CCCCATGATCAGGGGTGGCCAGG + Intergenic
1179850646 21:44136274-44136296 CCTTCTGAGCAGCTGTGCTCGGG + Intronic
1179863528 21:44204039-44204061 CCTGTGGAGCAGCTGTGGGCGGG + Intergenic
1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG + Exonic
1180192451 21:46172548-46172570 CCTCCTGACCAGCTGTGGGAAGG - Intronic
1181234970 22:21443212-21443234 CCTCCTGAACTGCTGTGGGCTGG + Intronic
1181419440 22:22787532-22787554 CCTGATGTGCACCTGGGGCCTGG + Intronic
1181433930 22:22899502-22899524 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181434868 22:22904871-22904893 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181436481 22:22914156-22914178 CCTCATGAGCAGATGCCACCAGG + Intergenic
1181740123 22:24914352-24914374 CCTCCTGAGTAGCTGTAGCTGGG - Intronic
1182269643 22:29145377-29145399 CCTCAGGAGGGGCTTTGGCCAGG - Intronic
1182324235 22:29499812-29499834 CCTCCTGAGTAGCTGGGACCTGG - Intergenic
1182357690 22:29729727-29729749 CCTCACCTGGAGCTGTGGCCTGG + Exonic
1182505631 22:30780322-30780344 ACTCCTCAGCAGCTGTGGCATGG - Intronic
1182850907 22:33473469-33473491 CCTCCTGAGCAGCTGGGACTAGG + Intronic
1183343850 22:37296211-37296233 CCCCATGGCCAGCTGTGGCTGGG + Intronic
1183380915 22:37490108-37490130 TCTGATGATCAGCTGTGGGCAGG + Intergenic
1183383471 22:37502136-37502158 CCTCAGGAGCCCCTGTGACCGGG - Intronic
1183905156 22:41034982-41035004 CCTCCTGAGTAGCTGGGGCTGGG + Intergenic
1183931198 22:41237181-41237203 CTTCCTGAACAGCAGTGGCCTGG - Exonic
1184198916 22:42951583-42951605 TGTCCTGAGCAGCTGTGTCCTGG - Intronic
1184844392 22:47072294-47072316 CCAAAGGAGAAGCTGTGGCCTGG - Intronic
1185202528 22:49516978-49517000 CCTAATGAGATGCGGTGGCCAGG - Intronic
951208389 3:19947539-19947561 CCTCCTGCGCAGCGGGGGCCTGG + Intronic
951208418 3:19947631-19947653 CCTCACGCGCAGCAGTGCCCTGG + Intronic
952214002 3:31257322-31257344 CCTTGTGGCCAGCTGTGGCCAGG - Intergenic
954102162 3:48382032-48382054 CCTCAGGAGCTGCTGTCACCTGG + Exonic
954198849 3:49012437-49012459 TCTCATGGGCAGCTATGGCCCGG - Exonic
956109280 3:65854720-65854742 CTAAATGAGCTGCTGTGGCCTGG + Intronic
956585014 3:70854944-70854966 GCACATGTGTAGCTGTGGCCTGG - Intergenic
961907764 3:130280297-130280319 CCCCATAAGCAGCTGTGGGATGG - Intergenic
962347576 3:134629637-134629659 CTTCTTGAGCAGCTGGGGCATGG + Exonic
962773087 3:138631291-138631313 CCTCCTGAGCAGCGGGGACCAGG - Intronic
962885287 3:139619523-139619545 CCTCAGGAGAAGCTTTGGCATGG - Intronic
963106999 3:141655989-141656011 CCTCATGAGCAACTCTGAGCTGG - Intergenic
965392597 3:168123013-168123035 CCTTTTGAGCAGCTGTGCCTGGG - Intergenic
966233236 3:177671951-177671973 CCTCCTGAGTAGCTGGGACCAGG - Intergenic
968599053 4:1500587-1500609 CCGCATCAGCAGCTGGGGACAGG + Intergenic
968727574 4:2255472-2255494 CCTGGAGAGCAGCAGTGGCCTGG + Intronic
971092327 4:23360446-23360468 CCCCATCTGCAGCTGTGGCTGGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972639351 4:40911631-40911653 CATCATAAGCTGCTGGGGCCTGG + Intronic
975737722 4:77397934-77397956 CCTCAAATGCAGTTGTGGCCTGG + Intronic
979779480 4:124632532-124632554 CCTGAGGGGCAGCTGAGGCCGGG - Intergenic
982405018 4:155009698-155009720 CCTCATTTGCAGCTATGGCATGG + Intergenic
983715457 4:170776469-170776491 CCTGATGACCAGCTGTGGAGAGG + Intergenic
985638969 5:1054321-1054343 CCTCCTGTGGGGCTGTGGCCGGG - Intronic
988349682 5:30086044-30086066 CCTCATGATCACCTGGGACCTGG + Intergenic
990444214 5:55878945-55878967 ATTCAAAAGCAGCTGTGGCCGGG - Intronic
991771692 5:70046937-70046959 CCACTTGAGCCGCTGTGCCCAGG - Intergenic
991850983 5:70922344-70922366 CCACTTGAGCCGCTGTGCCCAGG - Intergenic
992886801 5:81167630-81167652 CCCCATGAGCAGCTGCAGGCAGG + Intronic
994245132 5:97469489-97469511 CCTAATGAGCAGCTGGGGACTGG + Intergenic
995530328 5:113085811-113085833 CCTCCTGAGCAGCTGGGACTAGG + Intronic
996612472 5:125399073-125399095 CCTCATGCTCTGCTGTGGCTTGG + Intergenic
997954036 5:138264501-138264523 ACTCATGAACAGCTGTCTCCAGG - Exonic
998137660 5:139682632-139682654 CCTCCTGAGCCACTGTGCCCAGG - Intronic
998587559 5:143443408-143443430 CCTCCTCAGCTGCTGTGGCAGGG + Intergenic
1001400546 5:171443912-171443934 CTTCCGGGGCAGCTGTGGCCTGG + Intronic
1001982067 5:176044537-176044559 CCTGATGTCCATCTGTGGCCAGG + Intergenic
1002235395 5:177799520-177799542 CCTGATGTCCATCTGTGGCCAGG - Intergenic
1005493578 6:26369400-26369422 CATCATGGGGAGCTGTGGCGGGG + Intronic
1005502807 6:26444791-26444813 CATCATGGGGAGCTGTGGCGAGG + Intronic
1006349618 6:33511691-33511713 CCTCAGAAACAGCTGAGGCCTGG + Intergenic
1008701522 6:54106163-54106185 CCTCATGAGGAGCTCTGGAATGG + Intronic
1014252541 6:119129263-119129285 CCTCCTGAGGATCTGTGGCTGGG + Intronic
1016649034 6:146442455-146442477 CCTCATGGGCAGCTCAAGCCAGG + Intergenic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1018255000 6:161909714-161909736 CCTCAAGAGCACCTCTGACCAGG - Intronic
1019015720 6:168878483-168878505 CCTCAGGGGCAGCTTTGACCTGG - Intergenic
1019160075 6:170063617-170063639 GCACATTAGCAGCTGTGGCGTGG - Intergenic
1019409080 7:898808-898830 CCTGAGGAGCAGGTGGGGCCAGG + Exonic
1019597423 7:1864615-1864637 CCCCATGCGGGGCTGTGGCCTGG + Intronic
1023673584 7:42605737-42605759 CCTCAAGGACAGCTGTGGTCAGG + Intergenic
1023949962 7:44836080-44836102 CGTCCTGAGCTGCTGTGACCAGG + Intronic
1025875837 7:65478986-65479008 CCTGGTGAGCAGCTATGGCAGGG - Intergenic
1027128961 7:75577207-75577229 CCTCCTGAGTAGCTGGGACCAGG - Intronic
1027205043 7:76091129-76091151 CCTCCTGAGTAGCTGTAGCTGGG - Intergenic
1027797979 7:82717800-82717822 CCTCCTGAGTAGCTGGAGCCAGG - Intergenic
1028150444 7:87365727-87365749 CCTCCTGAGTAGCTGGGACCAGG + Intronic
1029025662 7:97414394-97414416 CCTCTCAGGCAGCTGTGGCCTGG + Intergenic
1029626980 7:101726019-101726041 AGTCTTGGGCAGCTGTGGCCTGG - Intergenic
1032139287 7:129312108-129312130 CCTCCTGAGTAGCTGGGACCAGG + Intronic
1032862366 7:135892583-135892605 CCTCCTGAGTAGCTGGGACCGGG - Intergenic
1033876648 7:145827623-145827645 CCTCCCGAGTAGCTGTGGTCAGG + Intergenic
1035280452 7:157775313-157775335 ATTCATGAGCCGCAGTGGCCAGG + Intronic
1035324737 7:158057660-158057682 CCTCATGAGGAAGTGGGGCCTGG - Intronic
1035735689 8:1885898-1885920 GCTGGTCAGCAGCTGTGGCCTGG + Intronic
1037363788 8:18101474-18101496 CCTTATCAACAGCTGTGGACTGG - Intergenic
1037837007 8:22220490-22220512 CCTCATGCTCTGCTGGGGCCTGG - Exonic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1039590205 8:38739922-38739944 CCTGTTGGGCAGCAGTGGCCAGG + Intronic
1041376006 8:57209901-57209923 CCTCTGGAGCACTTGTGGCCTGG + Intergenic
1041376773 8:57214280-57214302 CCTCTGGAGCACTTGTGGCCTGG + Intergenic
1042095675 8:65213528-65213550 CCTCTGGAGCAGCTCTGGGCTGG + Intergenic
1042928633 8:73992212-73992234 GCTAATGAGCAGCTGGGGCAGGG - Intronic
1043393456 8:79813347-79813369 TCTCCTGAGCAGCTGTGCTCAGG - Intergenic
1043443575 8:80298193-80298215 CCTCATTAGCAGCAGTGTACTGG + Intergenic
1043625044 8:82245831-82245853 GTACATGAGCACCTGTGGCCAGG - Intergenic
1044617817 8:94160084-94160106 GCTCATCAGCATCAGTGGCCTGG + Exonic
1045504644 8:102769804-102769826 CCTCCTGAGTAGCTGGGACCAGG - Intergenic
1045506978 8:102785681-102785703 CCTCATGTGCAGCTGTACCTGGG + Intergenic
1045536276 8:103031403-103031425 CCTCATGAGAAGCTGAGATCCGG - Intronic
1047104450 8:121718092-121718114 ACTCATTAGCAGCTGTGGTCTGG + Intergenic
1048282065 8:133113019-133113041 ACTCATGAGTAACTGTGGTCTGG - Intronic
1049099397 8:140568419-140568441 CCTCCTCAGCAGCAGTGGACAGG - Intronic
1049555009 8:143277358-143277380 CCTGCTGGGCAGCAGTGGCCCGG + Intergenic
1049586527 8:143434982-143435004 CCTCCTGCGCAGCTGTGCTCTGG - Intergenic
1052549391 9:29928837-29928859 CCTCCTGAGCAGCTGGGACTGGG + Intergenic
1052737217 9:32354676-32354698 CCTCAGGAGTGGCTGTAGCCAGG + Intergenic
1053225691 9:36354312-36354334 CCTCCTGAGTAGCTGGGGCTAGG + Intronic
1053417193 9:37954052-37954074 CGTCCTGACCAGCAGTGGCCAGG - Intronic
1053645860 9:40119311-40119333 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1053759858 9:41344225-41344247 CCTGATGTTCAGCTGGGGCCTGG + Intergenic
1054326869 9:63717212-63717234 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1054349915 9:64012198-64012220 CCTGATGTCCAGCTGGGGCCTGG - Intergenic
1054538711 9:66256661-66256683 CCTGATGTTCAGCTGGGGCCTGG + Intergenic
1057108036 9:92439507-92439529 ACTCATGAAAAGCTGTGGCCAGG - Intronic
1057220351 9:93254326-93254348 CCTCGTGAGCAGCTCCTGCCTGG + Intronic
1057810280 9:98252070-98252092 CCTGATGATCTTCTGTGGCCAGG - Intronic
1058070621 9:100597716-100597738 CATCATGCCCAGCTGTGGGCTGG - Intergenic
1060964819 9:127706630-127706652 CCTGTTCTGCAGCTGTGGCCTGG - Intronic
1061972717 9:134053580-134053602 CCTCCTCTGCAGCTGTCGCCTGG - Exonic
1062559961 9:137137072-137137094 TCACAGGAGGAGCTGTGGCCTGG + Intergenic
1202793644 9_KI270719v1_random:102766-102788 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1186175429 X:6921259-6921281 CCTCCTGAGTAGCTGGGGCCAGG - Intergenic
1186534242 X:10330295-10330317 CCTCTTGGTCACCTGTGGCCGGG + Intergenic
1189311370 X:40020485-40020507 CCTCATGAGTAGCTGCTGGCTGG - Intergenic
1189325201 X:40107463-40107485 CCGCCTGAGCAGCTCTGGCGCGG - Intronic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1192182441 X:68924646-68924668 GCTCAGGAGCAGATGAGGCCTGG - Intergenic
1192466438 X:71359779-71359801 CCTCCTGAGTAGCTGTGACTAGG - Intergenic
1195874740 X:109527678-109527700 CCTCCTGAGTAGCTGGGACCAGG - Intergenic
1197446049 X:126552934-126552956 CCTGAGGAGTAGCTGAGGCCGGG + Intergenic
1198214696 X:134545530-134545552 ACTCATGAGCAACAGTGCCCAGG + Intergenic
1201274461 Y:12285203-12285225 CCTGGTGAGCAGCTGTGGAAGGG + Intergenic