ID: 1179983785

View in Genome Browser
Species Human (GRCh38)
Location 21:44910254-44910276
Sequence CAGGTGGGGAGGGGTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 0, 2: 9, 3: 106, 4: 831}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179983773_1179983785 -4 Left 1179983773 21:44910235-44910257 CCCTCACCCAGGAGCTGGGCAGG 0: 1
1: 0
2: 8
3: 62
4: 508
Right 1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG 0: 1
1: 0
2: 9
3: 106
4: 831
1179983775_1179983785 -5 Left 1179983775 21:44910236-44910258 CCTCACCCAGGAGCTGGGCAGGT 0: 1
1: 0
2: 1
3: 77
4: 347
Right 1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG 0: 1
1: 0
2: 9
3: 106
4: 831
1179983767_1179983785 22 Left 1179983767 21:44910209-44910231 CCACTGGCTTCAGGGGCAGGAAA 0: 1
1: 0
2: 2
3: 37
4: 300
Right 1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG 0: 1
1: 0
2: 9
3: 106
4: 831
1179983779_1179983785 -10 Left 1179983779 21:44910241-44910263 CCCAGGAGCTGGGCAGGTGGGGA 0: 1
1: 0
2: 3
3: 76
4: 528
Right 1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG 0: 1
1: 0
2: 9
3: 106
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179983785 Original CRISPR CAGGTGGGGAGGGGTCCAGG AGG Intronic
900013279 1:133471-133493 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
900043344 1:489458-489480 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
900064781 1:724455-724477 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
900297490 1:1959339-1959361 CAGGTGGGGGTGGGTGGAGGGGG - Intronic
900464863 1:2820679-2820701 CAGGGGGCCAGGGGGCCAGGGGG + Intergenic
900589208 1:3452270-3452292 CAGGGAGGGAGGGGAGCAGGTGG + Intergenic
900684737 1:3940875-3940897 GAGGTGGGGAGGGGGCCAGAAGG - Intergenic
900754850 1:4426266-4426288 CAGGTGGGGAGAGCTCAAGGAGG - Intergenic
900972127 1:5997470-5997492 CAGGTGGGCAGGTGTGCAGTGGG - Intronic
901104313 1:6743507-6743529 CAGGTGGAGCAGGGTCCTGGAGG - Intergenic
901529337 1:9843529-9843551 CAGTTGGGGAAGGGACCTGGCGG - Intergenic
901741184 1:11343025-11343047 GAGGTGGGGAGAGGAGCAGGAGG + Intergenic
901930870 1:12595590-12595612 CGGGTGAGGAGGGGGCCAGGTGG + Intronic
901935638 1:12624699-12624721 CAGGTGGGGAGGCAGACAGGAGG + Intergenic
902279276 1:15362522-15362544 AAGGTGGAGAGGGCTGCAGGTGG + Intronic
902763143 1:18597497-18597519 CAGGTGTGGAGGGGTACCTGGGG + Intergenic
903212797 1:21828210-21828232 CCGGAGGGGAGGGGCACAGGTGG - Intronic
903578090 1:24351590-24351612 CAGGTGGGGCTGGAGCCAGGGGG - Intronic
903800546 1:25964011-25964033 CAGCAGGGGAGGAGGCCAGGAGG + Intronic
904260690 1:29285955-29285977 CAGGTGGGGAAGGGTGGAGCTGG - Intronic
904359498 1:29962746-29962768 CAGGTGGTGAGAGGAGCAGGCGG + Intergenic
904885307 1:33733271-33733293 CAGGTGGTAAGGGGCACAGGTGG - Intronic
905218890 1:36430396-36430418 CAGGAGGAGAGGGGCCCAGTTGG + Intronic
905580919 1:39082061-39082083 CAGGTGGGGAGGGTCGCAGGGGG + Intronic
905704270 1:40042365-40042387 CAGGTGCCCAGGGTTCCAGGAGG + Intronic
905864368 1:41368650-41368672 GAGGTGGGAGGGGGGCCAGGTGG + Intronic
906057087 1:42925700-42925722 TGTGTGGGGAGGGGTGCAGGAGG + Exonic
906274528 1:44506268-44506290 CGGGTGTGGAGGGGTGAAGGGGG + Intronic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
908477703 1:64505700-64505722 GAGGGGCGGCGGGGTCCAGGGGG - Intronic
908734563 1:67262601-67262623 GAGGTGGGGAGTGGTCAGGGTGG - Intergenic
909544571 1:76831598-76831620 CAGGTGGGGTTGGGCCCATGTGG - Intergenic
909934847 1:81539320-81539342 CTGGTGGGGAGGGGTGGTGGTGG - Intronic
910077607 1:83299064-83299086 CAGGTGGGGATGGGGCTAGGTGG - Intergenic
910100242 1:83568129-83568151 CAGATGGGGATGGCTCCAAGTGG - Intergenic
910361574 1:86417745-86417767 CAGGTGGAGTGGGGGCCAGTTGG - Intergenic
911055867 1:93708034-93708056 CAGGAGGGGAGGGGTGCGGGAGG + Intronic
912382109 1:109253387-109253409 CAGGTAAGGAAGGGCCCAGGTGG + Exonic
912448953 1:109758124-109758146 GTGGTGGGGAGGGGTGCGGGGGG - Intronic
912491503 1:110065087-110065109 CAGCTGGGGAGGGGGCCCTGGGG + Intronic
912554841 1:110508465-110508487 CTGGTGGGCAGGGCTCCCGGAGG - Intergenic
912631228 1:111248339-111248361 TTGGTGGGGAGGGGCACAGGAGG - Intergenic
914195430 1:145445916-145445938 CAAGTGGGGACTGGACCAGGTGG - Intergenic
914772087 1:150696787-150696809 CAGGGGGGGAGGGGGAGAGGGGG + Intronic
915118436 1:153614327-153614349 CATGTGGGGAGAGGACCAGCTGG - Exonic
915270522 1:154750306-154750328 TGGGTGAGGAGGGGTGCAGGAGG - Intronic
915304200 1:154968677-154968699 CATGTGGGGAGAGGGCCAGGAGG - Intronic
915340583 1:155174709-155174731 CCGGTGGGGAGGGGGCGAGTAGG + Intronic
915589886 1:156864708-156864730 GTGCTGGGGAGGGGTGCAGGAGG - Exonic
916445912 1:164871571-164871593 CAGGTGGGATGGGGTCTTGGAGG + Intronic
918041610 1:180917122-180917144 CAGGTGGTGGGGGGAGCAGGAGG + Intronic
918658099 1:187054068-187054090 CAGGTGGGGAGGGGACTGCGGGG - Intergenic
920665594 1:207960461-207960483 GAGGATGGGAAGGGTCCAGGTGG - Intergenic
921058261 1:211561025-211561047 CAGGCAGGGAGGGGTAAAGGAGG - Intergenic
921190004 1:212700163-212700185 CCGGGGGGGTGGGGACCAGGGGG + Intergenic
921347983 1:214206794-214206816 CAGATGGGGAGGATTCCATGTGG - Intergenic
922000258 1:221470139-221470161 CAGGTGGGTAGGGAGCAAGGAGG + Intergenic
922099680 1:222470474-222470496 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
922174880 1:223189435-223189457 CAGGTGGGGGCTGGTGCAGGTGG + Intergenic
922174942 1:223189643-223189665 CAGGTGGGGGCTGGTGCAGGTGG + Intergenic
922174973 1:223189755-223189777 CAGGTGGGGGCTGGTGCAGGTGG + Intergenic
922558693 1:226551411-226551433 CAGGTGGAGAGGGGAGCAGAGGG - Intronic
923037064 1:230291885-230291907 GAGGTGGGGAGCGGTGAAGGAGG + Intergenic
923621485 1:235582926-235582948 CATGAGGGGAGGGGTCAGGGAGG + Intronic
924342882 1:243052143-243052165 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
924453380 1:244198954-244198976 CAGGTGGGGTGAGGTGAAGGCGG - Intergenic
924599866 1:245478999-245479021 GAGATGGGGAGGGGTCCTGAGGG + Intronic
1062903118 10:1160635-1160657 CAGGTAGGGACGGTTCCCGGAGG + Intergenic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1063126670 10:3142290-3142312 CAGATGGGGAGGTGTGTAGGAGG - Intronic
1063375800 10:5553593-5553615 GAGGTGGGGAGGAGCCCAGCGGG + Intergenic
1064860334 10:19817994-19818016 GCGGTGGGCAGGGTTCCAGGAGG - Intronic
1065856971 10:29838886-29838908 GAGATGGGGAGGAGTGCAGGAGG + Intergenic
1065856981 10:29838909-29838931 GAGGAGGGGAGGGGTGCTGGAGG + Intergenic
1065973455 10:30822927-30822949 CAGGTGGGAAGGGTTGAAGGTGG - Intronic
1066025984 10:31361552-31361574 CAGATGGTGAGGGGGCCGGGTGG + Intronic
1066733601 10:38453411-38453433 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1066995651 10:42560407-42560429 CAGATGGGGGAGGGTACAGGGGG - Intergenic
1067041179 10:42954038-42954060 CAGGTGTGCAGGGGTCTTGGGGG + Intergenic
1067269978 10:44783160-44783182 CAGATCAGGAGGAGTCCAGGTGG - Intergenic
1067297696 10:44984234-44984256 CACCTGGGTAGGGGTCCAGCAGG - Intronic
1067480963 10:46597431-46597453 CACGTGGGGAAGGCTCCTGGTGG - Intergenic
1067544891 10:47185393-47185415 AAGGTGGGGAGGGGCCCAGGCGG - Intergenic
1067613790 10:47744391-47744413 CACGTGGGGAAGGCTCCTGGTGG + Intergenic
1069738061 10:70670480-70670502 AAGGTGGGGAGAGGGCAAGGTGG - Intergenic
1069782094 10:70963258-70963280 GGGGTGGGGAGGGGACCACGGGG + Intergenic
1070395606 10:76009217-76009239 GAGGTGGGGAGGGGGCTAGTGGG - Intronic
1070439859 10:76432845-76432867 CATGTGGGGAGGGGGCAATGAGG - Intronic
1071283731 10:84125560-84125582 GGGGTGGGGAGGGGGCGAGGAGG - Intergenic
1071629200 10:87204363-87204385 CACGTGGGGAAGGCTCCTGGCGG + Intergenic
1071972343 10:90921085-90921107 CCGGTGTGGAGGGGCCCAGCAGG - Exonic
1072474975 10:95751356-95751378 GATGTGGGGAGGGGTCTAGGAGG + Intronic
1072615916 10:97048860-97048882 CAGGTGGGCAGGTATGCAGGTGG + Intronic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1072641003 10:97211340-97211362 GAGGCGGGCAGGGGCCCAGGAGG - Intronic
1072711526 10:97718666-97718688 CAGGTGGGGTGTGGTCCAGGAGG - Intergenic
1072781965 10:98257552-98257574 CTAGCGGGGAGAGGTCCAGGAGG - Intronic
1073480759 10:103784809-103784831 GATGTGGGGAGGGGTCCAGATGG + Intronic
1075031131 10:119025489-119025511 CAGCTTGGCCGGGGTCCAGGCGG - Intergenic
1075086739 10:119418840-119418862 CAGGTTGGAAGGGGTCTTGGTGG - Intronic
1075292250 10:121240553-121240575 CAGGAGGGGCAGGGTCTAGGAGG - Intergenic
1076035234 10:127194965-127194987 CAGCAGGAGAGGGGTCCGGGCGG + Intronic
1076193633 10:128499742-128499764 CAGGTGGGGAGGGGCCCAGCAGG + Intergenic
1076365326 10:129918076-129918098 CAGTTAGGAAGGGGCCCAGGTGG + Intronic
1076379015 10:130012343-130012365 CAAGTGGCGAGGGGTGCAGGTGG + Intergenic
1076408418 10:130229341-130229363 CAGGTGGGAAGAGCTCCAAGAGG + Intergenic
1076836944 10:133025888-133025910 TAGGTGGGGAGGGTCCCGGGTGG + Intergenic
1076849410 10:133085818-133085840 CAGCGGGGGAGGGGCCCTGGGGG + Intronic
1076876777 10:133220110-133220132 CAGGTGAGGAGGGGCTCAGGCGG + Exonic
1076876787 10:133220142-133220164 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876797 10:133220174-133220196 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876807 10:133220206-133220228 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876817 10:133220238-133220260 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876827 10:133220270-133220292 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876837 10:133220302-133220324 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876847 10:133220334-133220356 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876857 10:133220366-133220388 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876865 10:133220398-133220420 CAGGTGAGGAGGTGCTCAGGCGG + Intronic
1076876875 10:133220430-133220452 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876885 10:133220462-133220484 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876895 10:133220494-133220516 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876905 10:133220526-133220548 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876915 10:133220558-133220580 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876925 10:133220590-133220612 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876935 10:133220622-133220644 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876945 10:133220654-133220676 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876955 10:133220686-133220708 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876965 10:133220718-133220740 CAGGAGAGGAGGGGCTCAGGCGG + Intronic
1076876975 10:133220750-133220772 CAGGTGAGGAGGGGCTCAGGCGG + Intronic
1076876994 10:133220814-133220836 CAGGTCAGGAGGGGCTCAGGTGG + Intronic
1076969615 11:125675-125697 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
1077015927 11:399254-399276 CAGGTGGGGAGGAAGGCAGGGGG - Intronic
1077016034 11:399513-399535 CAGGTGGAGGGGGGGACAGGTGG - Intronic
1077034028 11:486284-486306 CATGCGGGGAGGGGTCGGGGTGG + Intronic
1077107863 11:849746-849768 GAGGAGGGGAGGGGTCCGCGCGG + Intronic
1077186692 11:1238645-1238667 CAGGTGGGCAGGGATATAGGTGG + Intronic
1077305022 11:1865076-1865098 CAGGGGGGCAGGGGTGCGGGAGG + Intronic
1077424336 11:2467293-2467315 CAGGGAGGCAGGGGCCCAGGAGG + Intronic
1077479500 11:2806955-2806977 CAGGTTGGGCGGGGTCCCTGGGG + Intronic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1077497247 11:2892266-2892288 GAGGTGGGTGGGGGTCCTGGTGG - Intronic
1077919842 11:6633737-6633759 CAGGTGGGGAGGGGGACCTGGGG + Intronic
1078251073 11:9617018-9617040 CAGGAGTGGAGTGGGCCAGGAGG + Intergenic
1078561509 11:12377326-12377348 CAGGTTGGGAGCGGTCGAGCCGG - Exonic
1079238049 11:18703437-18703459 CAAGTGGGGAGGGGAGGAGGTGG - Exonic
1080944037 11:36950961-36950983 AAGGGGGGGAGGGGTGCAAGTGG + Intergenic
1081549174 11:44096184-44096206 CAGGAAGGGAGGGGTCACGGCGG - Exonic
1081670070 11:44937742-44937764 CAGGTGGGGAGGGTCACATGAGG + Intronic
1081796680 11:45825375-45825397 CTGGTGGGGAGGGTGTCAGGGGG - Intergenic
1081834445 11:46142763-46142785 CGGGTGGGAGGAGGTCCAGGTGG - Intergenic
1081847658 11:46252296-46252318 CAGGTAGGGAGTGGCCCAGCTGG - Intergenic
1081876216 11:46410036-46410058 CAGGATGGGAGAGGGCCAGGGGG + Intronic
1083261746 11:61526890-61526912 CAGGTGGGGAAAGGTCCCTGGGG + Intronic
1083305237 11:61758477-61758499 CAGGCGGGGAGGGGGCTTGGAGG + Intronic
1083308507 11:61772802-61772824 CAGGTGGGTGGAGCTCCAGGAGG + Intronic
1083673989 11:64315496-64315518 AAGGTGGGGAGGGTACAAGGTGG + Intronic
1083815486 11:65130305-65130327 CAGGTGGAAAGGGGCCCATGGGG + Exonic
1083879195 11:65539930-65539952 CAGGTGGGGTGGGGCGGAGGCGG - Intronic
1084164749 11:67370374-67370396 CTGGTGGGGAGGGGGAGAGGGGG - Intronic
1084191717 11:67502450-67502472 CAGGAGGGGAGCGGCCCTGGTGG - Intronic
1084312872 11:68326848-68326870 ATGGTGGGGAGGGGTCCCCGGGG + Intronic
1084408176 11:68991073-68991095 CAGGTGGGAAGGGGAGCTGGGGG + Intergenic
1084481424 11:69422921-69422943 CAGGGGTGGAGGGGTGCCGGAGG - Intergenic
1084493463 11:69490558-69490580 CAGGTGAGGTGGGGTCCCTGAGG + Intergenic
1084527330 11:69705104-69705126 CTGGTGGGGAGGGGTCGGGAAGG + Intergenic
1084687248 11:70703889-70703911 CAGGTGGGGAGGGGGCAGGGTGG - Intronic
1084689537 11:70716908-70716930 CAGGCTGGGAGGGGTCCAGTTGG - Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1088895785 11:114077358-114077380 GAGGTGGCCTGGGGTCCAGGTGG - Intronic
1089280558 11:117371375-117371397 CAGGAGAGGAGGGTTCCAGGAGG + Exonic
1089560241 11:119340036-119340058 GAGCGGGGGAGGGGCCCAGGCGG - Intronic
1090405398 11:126473238-126473260 TGGGTGGGGAGGGGGCTAGGTGG - Intronic
1090670286 11:128941040-128941062 CAGAAGGGCAGGGGTGCAGGGGG + Intronic
1090752591 11:129760429-129760451 GAGGTGTGGAGGGGCCCAGGGGG - Intergenic
1091224973 11:133951682-133951704 CAGGTGGGGAGAGGGGCAGTGGG - Intronic
1091277574 11:134362760-134362782 GAGGAGGGGATGGGCCCAGGTGG + Intronic
1091405506 12:206868-206890 CAGGTGGGAAGGAGTCCCGTGGG - Intronic
1091442776 12:524459-524481 CAGGTGGGGAGAGGGCAGGGTGG + Intronic
1091591115 12:1843455-1843477 CAGGTGGGGTGAGCCCCAGGAGG - Intronic
1091701226 12:2664746-2664768 CAGGTGGGGAGGGATGCAGAGGG + Intronic
1091775101 12:3179296-3179318 CAGGTGGGGTGGGGTTCAACCGG + Intronic
1091804821 12:3348252-3348274 CCTGTGGGTAGGGCTCCAGGAGG + Intergenic
1091951222 12:4594564-4594586 CAGGGAGGGAGGGGTTGAGGAGG - Intronic
1092107247 12:5930603-5930625 CACTTGAGGAGGGGTCCAGGGGG - Intronic
1092170376 12:6370539-6370561 CAGGTGGGATGGGGCCTAGGCGG - Intronic
1093163236 12:15774316-15774338 CAGGGGGGGTGGGGTGAAGGAGG - Intronic
1093181009 12:15966909-15966931 CAGGTGGCCCCGGGTCCAGGTGG - Intronic
1094318029 12:29153493-29153515 CAGTTGGAGAGGGGAGCAGGTGG + Intronic
1094494518 12:30981010-30981032 CAGGTTGGGAGGGTTCCATGGGG + Intronic
1094783278 12:33817956-33817978 CAGTTGGGGAGGGGTACTGGTGG + Intergenic
1095950336 12:47778266-47778288 GGGGTGGGGAGCGGTGCAGGTGG + Intronic
1096218441 12:49811442-49811464 GAGGTGGGGAGGGTTCCGAGGGG - Intronic
1096226362 12:49869154-49869176 CCTGTGGGGAGGGAACCAGGAGG - Exonic
1096559431 12:52424983-52425005 CAGGAGGAGAGGGCTCCAGTAGG - Intronic
1096687129 12:53295637-53295659 CAGGTGGGGACGGGCCCCAGAGG + Exonic
1096777751 12:53974310-53974332 GAGGAGGGGAGGGGTGGAGGGGG + Intronic
1096778097 12:53975861-53975883 AAGGTGGGGCGGGGTAGAGGGGG - Exonic
1096976998 12:55705136-55705158 GAGGAGGGGAGGGGCCCATGTGG + Intronic
1097038060 12:56137136-56137158 CATGTGGGGTGGGGTAGAGGAGG - Intronic
1097270269 12:57769752-57769774 CAGGTGGGGAGGGGCCCTGGTGG - Exonic
1098496715 12:71143864-71143886 CAGGTGGGAAGGGGCCAAAGTGG - Intronic
1098673919 12:73265854-73265876 CAGGAGGGGATGGGCTCAGGAGG - Intergenic
1099189408 12:79547314-79547336 GAGATGGGGCGGGGTGCAGGGGG - Intergenic
1100003394 12:89864662-89864684 CATGTGGGGATGGGAACAGGAGG + Intergenic
1100854441 12:98746287-98746309 CAGGTGGGCAGGGGTACTGGAGG - Intronic
1100861508 12:98811559-98811581 CTGGTGAGAAGGGGTCCAGGAGG - Intronic
1101721633 12:107355353-107355375 CAGGTGGGGACTGGACCACGTGG + Intronic
1102203949 12:111077406-111077428 CAGGGGGGCAGAAGTCCAGGGGG - Intronic
1102497471 12:113329568-113329590 GAGCTGGGGAGGGGTCCTGAGGG - Intronic
1102597596 12:114004756-114004778 CAGGGTGGAAGGGGACCAGGAGG - Intergenic
1102826602 12:115952297-115952319 GAGGTGGGGTGTGTTCCAGGTGG - Intergenic
1102968932 12:117150682-117150704 CACGTGTGGAGGGATCGAGGTGG + Intronic
1103020945 12:117533864-117533886 CACATGGGGAGGAGTCAAGGAGG - Intronic
1103360471 12:120350628-120350650 CACGTGGGGTGGGCTGCAGGGGG - Intronic
1103565181 12:121811818-121811840 CAGGTGGCTGGGGCTCCAGGGGG + Intronic
1103608833 12:122108569-122108591 GAGGTGGGGAGGAGTCGAGCAGG - Intronic
1104702640 12:130918667-130918689 CAGGTGGTTTGGGGGCCAGGTGG + Intergenic
1104731753 12:131108988-131109010 CAGGTGGGGATGGGGGGAGGTGG + Intronic
1104823509 12:131692667-131692689 GAGGCGGGGAGGGGGACAGGAGG + Intergenic
1104935420 12:132361627-132361649 CAGGTGGGAACAGGTCCGGGCGG + Intergenic
1104954610 12:132458030-132458052 CGGGTGGGTAGGTGACCAGGTGG + Intergenic
1105016059 12:132787484-132787506 CTTGTGGGGAGGGTTCCCGGGGG - Intronic
1105293661 13:19070754-19070776 TAGGAGGGGAGGAGTGCAGGAGG - Intergenic
1105841699 13:24259314-24259336 CAGGTGGGGATGGCTCCACTTGG - Intronic
1105873825 13:24535953-24535975 CAGGTGGGTAGGTGTCCCTGAGG - Intergenic
1105882461 13:24616280-24616302 CAGGAGGCGTGGGGTCCAGTGGG - Intergenic
1106163349 13:27219804-27219826 CAGGTGGCATGGGTTCCAGGTGG + Intergenic
1106229311 13:27809566-27809588 CAGGTGTGGAGGAGTTGAGGAGG + Intergenic
1107911441 13:45108984-45109006 CCGGGTGGGAGGGGTCCGGGAGG - Intergenic
1108522620 13:51259489-51259511 TATGTGGGGAGGGGATCAGGCGG - Intronic
1108526333 13:51288661-51288683 GAGGTGGGGGGGGGAGCAGGAGG - Intergenic
1108586079 13:51871037-51871059 ATGGTGGGGAGGGGGCCAGGCGG - Intergenic
1109745487 13:66617954-66617976 CAGGTGGGAGGGGGTCCCTGGGG + Intronic
1109915921 13:68984887-68984909 CTGGAGGGGAGGAGTCCAGGCGG + Intergenic
1112163722 13:96895678-96895700 CATGTGGGGATGGCTCCATGTGG - Intergenic
1112334308 13:98501361-98501383 GGGGTGGGGCGGGGGCCAGGAGG + Intronic
1112383937 13:98920162-98920184 AAGGAGGGGAGGAGTCCAGAAGG + Intronic
1112744919 13:102516158-102516180 CATTTGGGGAGGGGTCGGGGAGG + Intergenic
1113650410 13:112030336-112030358 CTGGGGGAGAAGGGTCCAGGTGG + Intergenic
1113914138 13:113860967-113860989 CAGGTGAGCAGGTGGCCAGGTGG + Intronic
1114555740 14:23561344-23561366 CTCCTGGGGAGGGGTCCAGATGG + Exonic
1115566459 14:34629625-34629647 CACGCGGGGCGGGGTGCAGGTGG - Intronic
1118175955 14:63440227-63440249 GAGGTGAGGAGGAGCCCAGGAGG - Intronic
1118740638 14:68737082-68737104 CAGCTGGGGTGGGCTCCAGAGGG - Intergenic
1119435535 14:74595493-74595515 CAGGCTGGGAGGGGTCCCTGGGG + Intronic
1119770786 14:77219575-77219597 CAGGTGAGGAGGGGTCGAGATGG + Exonic
1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG + Intronic
1121024282 14:90603087-90603109 CAGGAGGGATGGGCTCCAGGTGG + Intronic
1121512554 14:94523179-94523201 CATTTGGGGAGGTGTCCAGGTGG - Intergenic
1121615511 14:95311200-95311222 CGGGTGGGGAGGGGGCTCGGAGG - Intronic
1121820597 14:96962801-96962823 CAGGAAGGGTGGAGTCCAGGTGG - Intergenic
1121964157 14:98288892-98288914 GAGGTGGGGAGGGGGCAGGGAGG + Intergenic
1122140351 14:99659793-99659815 CAGGTGGGGTGGGGTGGGGGCGG - Intronic
1122178242 14:99936766-99936788 CAGGTTGGGAGGGGAGGAGGAGG - Intronic
1122415703 14:101548587-101548609 CAGGTGGGAAGGGGCACAAGTGG + Intergenic
1122734909 14:103832733-103832755 AAGGGGGGGCGGGGTGCAGGGGG + Intronic
1122826940 14:104375083-104375105 CAGGGGGAGCGGGGTACAGGAGG + Intergenic
1122864326 14:104596707-104596729 CAGCTGGGGGTGGCTCCAGGTGG - Intronic
1123054214 14:105561596-105561618 CGGGTGGGGAGGGGCCGTGGAGG + Intergenic
1123065275 14:105616003-105616025 CAGGTGTGGGGTGGTCCATGTGG + Intergenic
1123069475 14:105635439-105635461 CAGGTGTGGGGTGGTCCACGTGG + Intergenic
1123078798 14:105682015-105682037 CGGGTGGGGAGGGGCCGTGGAGG + Intergenic
1123088571 14:105731224-105731246 CAGGTGTGGGGTGGTCCATGTGG + Intergenic
1202895968 14_GL000194v1_random:10704-10726 CAGGGGTTGAGGGGGCCAGGGGG - Intergenic
1123496624 15:20833512-20833534 CAGCTGGGGTGTGGGCCAGGGGG + Intergenic
1123553859 15:21407104-21407126 CAGCTGGGGTGTGGGCCAGGGGG + Intergenic
1123590103 15:21844469-21844491 CAGCTGGGGTGTGGGCCAGGGGG + Intergenic
1123711334 15:22989962-22989984 CAGGAGGTGAGAGATCCAGGCGG - Intronic
1123987654 15:25659337-25659359 CGGGTGGGGAGGCCTCCAGAGGG - Intergenic
1124340460 15:28886516-28886538 CGGGCGGGGCGGGGACCAGGCGG + Intronic
1124826433 15:33100515-33100537 GAGGAGGGGAGGGGTCAAGATGG + Intronic
1127854231 15:62941548-62941570 CAGGTGCTGTGGGGTCCAGAGGG - Intergenic
1127867681 15:63044848-63044870 CAGGTGGGGGCGGGGCCAGCAGG - Intronic
1129192095 15:73943139-73943161 CAGGAGGGGAGGGGAGCAAGCGG + Intronic
1129672677 15:77615972-77615994 CAGGGCAGGAGGGGCCCAGGTGG - Intronic
1129683382 15:77671076-77671098 CAGCTGGGGAGGGGCCCTGCGGG - Intronic
1130650868 15:85761389-85761411 CAGATGGGCAGGGGCCCTGGTGG + Intronic
1131259234 15:90879999-90880021 CAGGCTGGGAGGGGGCCAGTGGG + Intronic
1131263677 15:90903152-90903174 CGGGTGGGGAGGGAGCCGGGCGG + Exonic
1131431248 15:92390976-92390998 CAGGAGGGGAGGGGTCAGGGTGG + Intergenic
1131434515 15:92412339-92412361 GAGGTGGGGAGGGGAAGAGGAGG + Intronic
1131836452 15:96396086-96396108 CCGATGGGCAGGGCTCCAGGTGG + Intergenic
1132411185 15:101579289-101579311 GAAGTGGGGAGGGGGGCAGGGGG - Intergenic
1202962205 15_KI270727v1_random:134300-134322 CAGCTGGGGTGTGGGCCAGGGGG + Intergenic
1132514576 16:360181-360203 CAGGTGGGCGGGGGCGCAGGTGG - Intergenic
1132540192 16:504847-504869 CAGGAGGTGAGGGGTGCAGGAGG - Intronic
1132550688 16:552769-552791 GAGGTGGGTGGGGGTCCCGGGGG + Exonic
1132612515 16:824448-824470 CAGGTGGGGGCTGGTCAAGGCGG - Intergenic
1132626554 16:894259-894281 CAGGTGGACAGGGGGACAGGTGG - Intronic
1132659599 16:1055452-1055474 AAGGGGAGGAGGGGGCCAGGAGG + Intergenic
1132767359 16:1541272-1541294 CAGGAGGTGAGGGGGGCAGGTGG + Intronic
1132981355 16:2740060-2740082 CAGGGGGTGAGGGGGCCAGTGGG - Intergenic
1133020228 16:2963934-2963956 AAGGTGTGGAGGGGGACAGGCGG - Exonic
1133970668 16:10565692-10565714 GAGGTGGGGAGGGATCCAACAGG + Intronic
1133985681 16:10666311-10666333 CAGGAGGGGAGGGTTTGAGGAGG - Intronic
1134044756 16:11093068-11093090 GAGGTGGTGGGGGGTACAGGAGG - Intronic
1134539565 16:15054104-15054126 CAGGAGGGGAAGGGCCCAGTGGG - Intronic
1134574111 16:15317368-15317390 CAGGTGGGAAGGGGTCTTGATGG - Intergenic
1134688529 16:16175465-16175487 CACGTGGGCAAGGGGCCAGGAGG - Intronic
1134728310 16:16438933-16438955 CAGGTGGGAAGGGGTCTTGATGG + Intergenic
1134939129 16:18272899-18272921 CAGGTGGGAAGGGGTCTTGATGG - Intergenic
1135142251 16:19931837-19931859 CATGTGGGGAGGGGTACAGCAGG + Intergenic
1136233606 16:28902089-28902111 CAGCTGGGTGGGCGTCCAGGAGG + Intronic
1136413637 16:30091127-30091149 CAGGTTGGGCGGGCCCCAGGCGG + Exonic
1136580457 16:31148398-31148420 CGGCTGGGGAGACGTCCAGGAGG - Exonic
1136605163 16:31329081-31329103 GAGATGGGGTGGGGTGCAGGGGG - Intronic
1137534150 16:49304801-49304823 GAGGAGGGGAGGGATCCAGGAGG + Intergenic
1137758911 16:50924958-50924980 CAGGTGGGGAGTGGGGGAGGGGG - Intergenic
1139518074 16:67463747-67463769 CAGGGTGGGTGGGGTCCTGGGGG - Intronic
1139754407 16:69131813-69131835 CGAGTGGGGTGGGGTCCTGGAGG - Intronic
1139953193 16:70681689-70681711 CAGGAGGGGAGGGGAGCAGGGGG - Intronic
1140148208 16:72333017-72333039 CAGCTGGGGTGGGGTACTGGTGG + Intergenic
1141569878 16:84928088-84928110 CAGGTGGCCAGGGGCCAAGGCGG - Intergenic
1141634534 16:85307031-85307053 CAGGTTGGGAAGTGTCCACGAGG + Intergenic
1141690056 16:85591531-85591553 GTGCTGGGGAGGGGTCCTGGAGG + Intergenic
1141815751 16:86408276-86408298 CAGGTGGGGGGTGGGCCTGGAGG + Intergenic
1142015093 16:87741350-87741372 CAGGAGGTGAGGGGGCCAGCAGG + Intronic
1142028839 16:87828520-87828542 CAGCTGGGCTGGGGGCCAGGCGG + Intergenic
1142225921 16:88877655-88877677 GAGGTGGGGAGGGGGACGGGTGG - Intronic
1142286397 16:89173224-89173246 CAGGTGGGGAAGGGCCCTGGAGG - Intronic
1142402899 16:89870279-89870301 CAGGTGGCCAGGCCTCCAGGAGG + Exonic
1142451064 16:90173447-90173469 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1142456499 17:60248-60270 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
1142481921 17:224304-224326 CAGGTGGCGTGGGATGCAGGAGG - Intronic
1142492935 17:290290-290312 GAGGTGGGGTGGTGGCCAGGTGG + Intronic
1142617411 17:1144393-1144415 GAGGTGGGCATGGGGCCAGGAGG + Intronic
1142619197 17:1154281-1154303 CAGGCGGGGAGGGGACCGTGTGG - Intronic
1142715509 17:1745078-1745100 AAGGTGGGGTGGGGTGGAGGGGG + Intronic
1142848676 17:2694091-2694113 CAGGTGGGGCTGGGTGGAGGTGG - Intronic
1143568365 17:7739051-7739073 GAGGTGGGGAGGGATTCTGGAGG - Intronic
1143670567 17:8393119-8393141 CAGGGGAGGAGGCGGCCAGGGGG + Exonic
1143999584 17:11040540-11040562 CAGCTGGGAAGGGGTACAGAGGG + Intergenic
1144163169 17:12581639-12581661 GGGGTGGGGAGGGGCACAGGTGG - Intergenic
1144312482 17:14025500-14025522 CAGTGGGTGAGGGGACCAGGAGG + Intergenic
1144332270 17:14235825-14235847 CAGTGGGTGAGGGGACCAGGAGG - Exonic
1144440655 17:15278343-15278365 AAGGTGGGGTGGGGGGCAGGCGG - Intergenic
1144498555 17:15765698-15765720 CAGGGGTTGAGGGGACCAGGAGG + Intergenic
1144730482 17:17523146-17523168 GAGGAGGGGAGGGGGCAAGGAGG + Intronic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144788988 17:17847201-17847223 CAGGGAGAGAGGGGCCCAGGAGG + Exonic
1144832762 17:18140663-18140685 GAGGTGGGGTGGGGGGCAGGTGG + Exonic
1144966251 17:19078533-19078555 AAGGAGGGCAGGGGGCCAGGTGG + Intergenic
1144981667 17:19173524-19173546 AAGGAGGGCAGGGGGCCAGGTGG - Intergenic
1144986557 17:19204715-19204737 AAGGAGGGCAGGGGGCCAGGTGG + Intergenic
1145161937 17:20580738-20580760 CAGGGGTTGAGGGGACCAGGAGG + Exonic
1145388331 17:22435310-22435332 GAGGAGGGGAGGGGTCGAGGCGG - Intergenic
1145810351 17:27760582-27760604 CAGGTGGGAGGGGCACCAGGGGG - Intronic
1146125857 17:30230782-30230804 CAGGTGGAGAGGGGGCGCGGAGG + Intronic
1146306376 17:31732876-31732898 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
1146666021 17:34704165-34704187 CAGGTGGGGAGGCGTCCTGCTGG - Intergenic
1147896552 17:43755316-43755338 CCGGTGGGGAGGGGCGCGGGCGG + Exonic
1148054636 17:44786840-44786862 CAAGCGGGCAGGGGTTCAGGTGG - Intergenic
1148555690 17:48577553-48577575 AAGTTGGGGAGGGGTGGAGGAGG - Intronic
1148646484 17:49222399-49222421 AAGCTGGGGAGGGGTCCTGAAGG + Intronic
1148688757 17:49514759-49514781 CAGGTGGGGAGGGGGTTTGGGGG + Exonic
1148868901 17:50643969-50643991 CAGGTGGGCAGGGGCACTGGAGG + Intronic
1149689721 17:58565101-58565123 CAGGAGAGCAGGGGGCCAGGTGG + Intronic
1150393626 17:64804814-64804836 CAGATGGGTAGGTGACCAGGAGG - Intergenic
1150410937 17:64940156-64940178 CAGATGGGTAGGTGACCAGGAGG - Intergenic
1151170217 17:72239407-72239429 CAGCTGGGGTGGGGTCAGGGTGG + Intergenic
1151204199 17:72493416-72493438 CAGGTGTGGAGGGGATGAGGTGG + Intergenic
1151326088 17:73380558-73380580 TAGGTGGGCAGGTGTCCACGTGG - Intronic
1151348078 17:73515527-73515549 CAGGGGGTGAGGGTTTCAGGTGG + Intronic
1151382567 17:73735793-73735815 CAGGTGGAGAGGGTGCCTGGAGG - Intergenic
1151477082 17:74350315-74350337 AAGGAGGGGAGGGGCCCAGGTGG + Intronic
1151478751 17:74357748-74357770 GAGGTGGGGCGGGGTCAGGGCGG + Intronic
1151570569 17:74923532-74923554 GAGCTGGGGAGGGGTGCCGGAGG + Intergenic
1152253119 17:79221915-79221937 CAGATGGGGAGGGGTGCAGAGGG + Intronic
1152279466 17:79376743-79376765 CAGGTGGGGAGGCTCGCAGGGGG + Intronic
1152377531 17:79926547-79926569 CAGATGGGGAGGGGGCGAGGTGG - Intergenic
1152474400 17:80508701-80508723 CAGGTGGGGAGGGGGCATGGTGG - Intergenic
1152594732 17:81232639-81232661 CAGGTAGGGAGGCCTCCTGGTGG + Intronic
1152612699 17:81323426-81323448 CAGGTGGGGAGGGGGCGACCTGG - Intronic
1152642518 17:81455111-81455133 CAGGGGGTGAGGGGCCCCGGGGG - Intronic
1152770560 17:82165644-82165666 CATGTGGGGAGGGTCACAGGAGG + Intronic
1152794714 17:82301360-82301382 GAGGTGGGGAAAGGGCCAGGAGG + Intergenic
1155041067 18:22066075-22066097 TAGGTGGGGTGGGGTGGAGGAGG - Intergenic
1155507926 18:26549523-26549545 CGGGTGGGGAAGGGTCCCTGTGG - Intronic
1156456439 18:37297232-37297254 CAGGTGGCGAGGGCACCGGGAGG + Intronic
1157478640 18:48038887-48038909 CAGGTGGGGAGGGCTCTGGTGGG - Intronic
1157568193 18:48694300-48694322 CAGGTGAGGAGGGCTGCAGGAGG + Intronic
1158940746 18:62404337-62404359 CGGGGAGGGCGGGGTCCAGGGGG + Intergenic
1159117996 18:64136970-64136992 GATTTGGGGAGGGGTGCAGGTGG - Intergenic
1160051971 18:75442198-75442220 TGGGTGGGGATGGGCCCAGGAGG + Intergenic
1160107892 18:75995091-75995113 CTGGTTGGGAGGGGGCCAGGAGG + Intergenic
1160208738 18:76858935-76858957 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208753 18:76858979-76859001 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208809 18:76859155-76859177 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208836 18:76859243-76859265 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160310820 18:77788469-77788491 CAGGAGGGGAGAGGTCTTGGAGG + Intergenic
1160369945 18:78363687-78363709 CAGCTGGGCAGGTGTCCCGGGGG - Intergenic
1160403602 18:78629329-78629351 CAGCTGGGGAGAGCTCCTGGTGG + Intergenic
1160511278 18:79454866-79454888 AAGGTGGGGAGGGGTGTGGGTGG - Intronic
1160540294 18:79617314-79617336 CCGGGGGGGCGGGGTCCCGGGGG - Intergenic
1160560807 18:79754820-79754842 CTGGCCGGGAGGGGTCCTGGCGG - Exonic
1160646420 19:195601-195623 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
1160753927 19:748028-748050 CAGGTGGTGACTGGACCAGGAGG - Exonic
1160796775 19:949285-949307 CAGGTGGGCAGGGTCCCTGGGGG - Intronic
1160810808 19:1012233-1012255 CAGCTGGGGCAGGGCCCAGGGGG - Intronic
1161083410 19:2322568-2322590 CATGTGGGGTGGGGACCATGTGG + Intronic
1161202867 19:3025555-3025577 CAGCTGGGGATGCCTCCAGGTGG + Intronic
1161242179 19:3228611-3228633 CAGGTGGGGGGGGGGCCCGGCGG + Intronic
1161258716 19:3323721-3323743 CAGGGGTGCAGGGGTCCAAGTGG - Intergenic
1161348507 19:3779513-3779535 AAGGTGGGGCGGGGCCCAGGCGG - Exonic
1161766421 19:6211330-6211352 CAGGTGGCGAGGAGTCCCGGAGG + Intergenic
1161767621 19:6216098-6216120 CTGGCAGGGAGGGGTGCAGGAGG - Intronic
1161776328 19:6264237-6264259 GGGGTGGGGAGGGGTGGAGGGGG - Intronic
1161817206 19:6506749-6506771 TAGGTGGGGAGGGGTTTTGGAGG - Intergenic
1161841257 19:6682060-6682082 CAGGGAGAGAGGGGTCCAGGAGG - Intronic
1161847311 19:6719129-6719151 CAGAAGGGGAGGGGCTCAGGAGG + Intronic
1162570138 19:11466781-11466803 CAGGTGGGGGGGGGCCCGGCCGG - Exonic
1163124366 19:15236754-15236776 GAGGTGGTCTGGGGTCCAGGGGG + Exonic
1163153257 19:15427174-15427196 CAGTTGGTGAGTGGCCCAGGGGG + Exonic
1163417354 19:17194754-17194776 CAGGTGAGGAGTGCTCTAGGGGG - Exonic
1163566135 19:18052286-18052308 GAGGTGGGGAGGGGAGGAGGGGG + Intergenic
1163646886 19:18494723-18494745 CAGGTGGGGAGGGGGAGGGGAGG - Intronic
1164672695 19:30081952-30081974 CATCTGGGGAGGGGGCCAGTGGG - Intergenic
1164740757 19:30573871-30573893 CATGTTGGAAGGTGTCCAGGAGG - Intronic
1165078380 19:33293619-33293641 GGGGTGGGGATGGGTCAAGGGGG - Intergenic
1165179073 19:33952385-33952407 CAGCTTGGGAGGTGTCCTGGGGG + Intergenic
1165247473 19:34505539-34505561 CAGGTGGGGGGAGGCACAGGTGG - Exonic
1165290320 19:34878764-34878786 CAGGTGAGGAGGGATCCAGGGGG - Intergenic
1165372636 19:35419024-35419046 GATGTGGGGAGGGGGACAGGGGG + Intergenic
1165559809 19:36669177-36669199 TTGGTGGGGAGGGGTCCTGGAGG + Intergenic
1165775724 19:38403335-38403357 CAGGTATGGAGGTGTCCCGGGGG + Exonic
1165829579 19:38723853-38723875 GGGGTGGGGAGGGGTCCAGAGGG - Intronic
1165832117 19:38735482-38735504 CAGGTGGGGACTGTTCCTGGAGG - Exonic
1166137770 19:40787600-40787622 CAGCAGGGGAGAGGCCCAGGGGG + Intronic
1166231575 19:41428006-41428028 CAAGTGGGAAGGTGGCCAGGAGG + Intronic
1166356506 19:42230484-42230506 CAGGAGGGGAGGGGGTCTGGAGG + Exonic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166921448 19:46231528-46231550 CAGGTGGGGTGGGGAGGAGGTGG + Intergenic
1167149610 19:47701436-47701458 CAGGTGTGGAGGGGGCTGGGTGG - Exonic
1167155556 19:47736531-47736553 CAGGTGGGAAGCTGCCCAGGAGG + Exonic
1167308443 19:48721948-48721970 CAGCTGGGCGGGGGTCAAGGTGG + Exonic
1167337905 19:48897801-48897823 CAGATGGGTAGGGGTGGAGGTGG - Intronic
1167618594 19:50549341-50549363 CAGGTGGCAAGGGGACCGGGCGG - Intronic
1167622343 19:50567146-50567168 CAGGAGGAGAGGTTTCCAGGAGG + Intronic
1167665204 19:50819538-50819560 CACATGGGGCAGGGTCCAGGTGG + Intronic
1167686114 19:50957876-50957898 GAGGTGGGGCTGGGCCCAGGAGG - Intergenic
1168147614 19:54428861-54428883 CGGGTGGGGAGGGGTGCAGGGGG - Intronic
1168233426 19:55047338-55047360 CAGGGGTGGAGGGCTCCACGTGG + Intronic
1168713560 19:58514750-58514772 CGGGTGGGTAGGGGTTGAGGGGG - Intronic
925208510 2:2027034-2027056 GAGGTGGCGAGGGGTCCAGGTGG - Intronic
925317451 2:2936969-2936991 AAGGTGAGGACGGGTTCAGGGGG + Intergenic
926010027 2:9400237-9400259 CAGGAGGGGAAGGGGGCAGGAGG - Intronic
926084663 2:10012936-10012958 CAGGTGGGCAGGTGTGCATGTGG + Intergenic
926084690 2:10013052-10013074 CAGGTGGGCAGGGGTGCATATGG + Intergenic
926647993 2:15310760-15310782 CAGGTGGGGAAGCATCCTGGTGG - Intronic
927154938 2:20216053-20216075 GAGGTGGGGAGGGAGGCAGGGGG + Intronic
927510530 2:23641394-23641416 CAGGAGGGGAGGGACCCTGGTGG - Intronic
927847505 2:26479221-26479243 CAGCAGGGGTGGGGTCCTGGGGG - Intronic
929454042 2:42054065-42054087 CCAGTGGGGAGTGGGCCAGGTGG - Exonic
929486756 2:42361547-42361569 TAGGAGGGGCGGGCTCCAGGCGG + Exonic
929877388 2:45808096-45808118 CAGGTGGTGAGGGTTACAGATGG - Intronic
930587215 2:53281519-53281541 CAGATGTGGAGAGGTCCATGTGG - Intergenic
931100798 2:58998765-58998787 CAGGTGTGGGAGGGACCAGGTGG + Intergenic
931283919 2:60816999-60817021 CATGTGGGGGCGGGGCCAGGGGG - Intergenic
931614756 2:64144434-64144456 AAGGAGGGGAGGGGTCTAGCCGG + Exonic
931746203 2:65293789-65293811 CAGGTCTGGGGGGGGCCAGGGGG + Intergenic
931904809 2:66831004-66831026 CTGCTGGGGAGGGGTAAAGGAGG + Intergenic
932467598 2:71933565-71933587 CTTGTGGGGAGGTGTCCAGCTGG + Intergenic
932593281 2:73079763-73079785 CAGGTGGGGAGGGCTCATGGGGG + Intronic
933121359 2:78542060-78542082 CAGGTGGGGGCGGGGCTAGGCGG - Intergenic
933789960 2:85875926-85875948 CCTGTGGGGAGGGGAGCAGGCGG - Intronic
933997427 2:87680056-87680078 AAGCTGGGGTGGGGGCCAGGTGG + Intergenic
934550703 2:95259887-95259909 CAGGTGGGGTGGGGAACAGCTGG - Intergenic
934646741 2:96063367-96063389 CAGCTGGGGAGGGGTGCATGGGG + Intergenic
934840144 2:97619449-97619471 CAGCTGGGGAGGGGCGCATGGGG + Intergenic
936296424 2:111270856-111270878 AAGCTGGGGTGGGGGCCAGGTGG - Intergenic
936384091 2:112013120-112013142 CATGTGGGCATGGGGCCAGGGGG - Intronic
936517013 2:113187337-113187359 GAGGTGGGGAAGGGACAAGGAGG - Intronic
936517543 2:113191988-113192010 GAGGTGGGGAAGGGACAAGGAGG + Intronic
936974255 2:118203567-118203589 GAGGTGGGGTGGTGTGCAGGGGG - Intergenic
937260209 2:120580723-120580745 CCAGTGGGAAGGGGTCCAGGAGG - Intergenic
937298293 2:120823072-120823094 CGGGTGGCGGGGGGTGCAGGGGG - Intronic
937314578 2:120922860-120922882 CAGGTAGGCAGGGCTGCAGGTGG - Intronic
937347073 2:121132619-121132641 CAGGGGGGGATGGGGCCACGTGG + Intergenic
937868810 2:126773122-126773144 CAGGTGTGGAGACTTCCAGGAGG + Intergenic
937939770 2:127275965-127275987 AAGGTGGGGAGGTGCACAGGAGG + Intronic
937967640 2:127526155-127526177 CAGGTGGGGCAGGGACCTGGGGG - Exonic
938492230 2:131767239-131767261 CAGGGGGTGAGGGGGCCAGGGGG + Exonic
938495337 2:131795104-131795126 CAGGGGGTGAGGGGGCCAGGGGG - Exonic
938697250 2:133845397-133845419 GAGGTGGGGAGGGCTGCAGCAGG - Intergenic
938931766 2:136092839-136092861 CAGGTCGGCAGTTGTCCAGGAGG - Intergenic
940677862 2:156746790-156746812 CAGATAGGGAGGGGTCCAGCAGG - Intergenic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
941653774 2:168121643-168121665 TAGGTGGGGTGGGGTGCAGATGG - Intronic
941673675 2:168321633-168321655 TTGGTGGGTAGGGGTCTAGGGGG + Intergenic
941843396 2:170110949-170110971 CAGGGGGGGTGTGGTCCTGGAGG - Intergenic
942135100 2:172917496-172917518 GGGTTGGGGAGGGGTGCAGGGGG + Intronic
942664899 2:178307137-178307159 CAGGGGGTGAGGGGTGGAGGGGG - Intronic
943669647 2:190648305-190648327 GAGGTGGGGAGGGGGCAAGATGG + Intronic
945080921 2:206085654-206085676 CGGGCGGGCAGGGGTCCAGCCGG - Intronic
946194289 2:218023891-218023913 CAGCTGGGGAAGGGTGTAGGGGG - Intergenic
947353995 2:229273254-229273276 TAGGTGTGGAGGTGTGCAGGAGG - Intergenic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
948571915 2:238923011-238923033 CAGGTGGGGAGGGAAGCAGGTGG - Intergenic
948602415 2:239115023-239115045 CAGGCGGGGAGGGCACCAGAAGG - Intronic
948703314 2:239774289-239774311 CAGGTGGGATGGTGTCGAGGGGG + Intronic
948710963 2:239825301-239825323 CCTGTGGGGAGGGGACCTGGGGG + Intergenic
948725369 2:239930779-239930801 GAGGAGGGGCAGGGTCCAGGAGG + Intronic
948725401 2:239930865-239930887 GAGGGGGGGCAGGGTCCAGGAGG + Intronic
948725433 2:239930951-239930973 GAGGGGGGGCAGGGTCCAGGAGG + Intronic
948773839 2:240269815-240269837 CAGGTGGGAAGTGCTCCAGTGGG + Intergenic
948852991 2:240717519-240717541 CAGGTGGTGAGGGAACCAGCGGG - Intronic
948908567 2:240991680-240991702 CAGGCTGGGAGGGTGCCAGGCGG - Intronic
948931437 2:241134892-241134914 CAGGTGGGCAGAGGCCCTGGAGG + Intronic
948950564 2:241248454-241248476 CAGGTGAGGTGGTCTCCAGGTGG + Intronic
948981808 2:241498376-241498398 CCAGTGGGGAGAGGGCCAGGAGG + Intronic
949005162 2:241641819-241641841 CGGGTGTGGAGAGGTCCAGGAGG + Intronic
1168760776 20:348080-348102 CAGGTGAGGAGGTGTGGAGGGGG - Intronic
1168830244 20:841642-841664 CTAGTGGGGAGGGGGCCAGGTGG + Intronic
1169991925 20:11513503-11513525 CAGGTGGGGCGGCTGCCAGGCGG + Intergenic
1170817063 20:19722330-19722352 CAGGAAGGGAGGGGTGCAGCTGG - Exonic
1170968754 20:21100234-21100256 GAGGGTGGGAGGGGTACAGGGGG + Intergenic
1172274475 20:33672341-33672363 CAGGGTGGGAGGCATCCAGGAGG - Intronic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1173326364 20:42037327-42037349 CAGGTGGGGAAGGGCCTAGAGGG - Intergenic
1173426086 20:42944634-42944656 AAAGTGGGGAGGTCTCCAGGTGG - Intronic
1173745427 20:45433112-45433134 TAGGTGGGGACGGGTCTTGGAGG + Intergenic
1173749868 20:45468776-45468798 CAGGTGGGAAGTGGTGGAGGTGG + Intergenic
1173821984 20:46025535-46025557 CAGGTGGGGTGGGGATCGGGGGG + Intronic
1173850258 20:46213248-46213270 CAGTGGGGGAGGGGACAAGGGGG + Intronic
1174167863 20:48598012-48598034 AAGGTGGGGAGAGGACCCGGAGG + Intergenic
1174282148 20:49447152-49447174 GTGCTGGGGAGGGGCCCAGGAGG + Intronic
1174358852 20:50015536-50015558 GAGGGGGGGAGGGGACGAGGGGG - Intergenic
1174448995 20:50608593-50608615 AAGGTGGGGATGGGGCCCGGGGG - Exonic
1174528437 20:51191940-51191962 AATGTGGGGAGGCGACCAGGAGG + Intergenic
1174601573 20:51729326-51729348 GAGGTGGGGTGGGGTGGAGGGGG - Intronic
1175195643 20:57241575-57241597 CAGGCGGGTAGGACTCCAGGTGG - Intronic
1175199389 20:57267118-57267140 TGAGTGGGGAGAGGTCCAGGCGG - Intergenic
1175222511 20:57425535-57425557 CAGCTGGGGAGGGGCCCAGATGG + Intergenic
1175441816 20:58997583-58997605 CAGGTGAGGAGAGGTCCCGCGGG - Exonic
1175522259 20:59609438-59609460 CAAGTGGGGTGGGCTCCAGGAGG - Intronic
1175689799 20:61057140-61057162 CAGGTGGGGAGGAGGCCCTGGGG - Intergenic
1175843868 20:62048718-62048740 CATGTGGGGAGAGGACCAGGGGG - Intronic
1175887691 20:62302155-62302177 CTGGAAGGGAGGGGTCCTGGAGG - Intronic
1176012389 20:62905842-62905864 AAGAACGGGAGGGGTCCAGGAGG + Intronic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176026106 20:62986414-62986436 CAGGTGGTCAGTGGTGCAGGTGG + Intergenic
1176026162 20:62986605-62986627 CAGGTGGGCGGGGGTGCGGGTGG + Intergenic
1176026189 20:62986687-62986709 CAGGTGGGCAGGGGTGCAGTTGG + Intergenic
1176034120 20:63028100-63028122 CCGGTGGGGAGGGGGCCGGCGGG + Intergenic
1176096281 20:63345916-63345938 CAGGTGGCCAGGGCTCCACGGGG - Exonic
1176138763 20:63536146-63536168 CAGGTGGGGGGGGGAGCGGGAGG - Intronic
1176191922 20:63815521-63815543 CAGGTGGGCACAGGTCCAGTGGG + Intronic
1176219855 20:63964727-63964749 CAGGTGAGGTGAGGGCCAGGAGG + Intronic
1176256933 20:64157927-64157949 CAGGTGGGGACAGGGGCAGGTGG - Intronic
1176256950 20:64157969-64157991 CAGGTGGGGACGGGGACAGGTGG - Intronic
1176256993 20:64158081-64158103 CAGGTGGGGACAGGGGCAGGTGG - Intronic
1176257055 20:64158270-64158292 CAGGTGGGGACAGGGACAGGTGG - Intronic
1176257082 20:64158351-64158373 CAGGTGGGGACAGGGGCAGGTGG - Intronic
1176257170 20:64158596-64158618 CAGGTGGGGACAGGGACAGGTGG - Intronic
1176279091 20:64290615-64290637 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1176293590 21:5059090-5059112 CAGATGGGGATGGCTGCAGGGGG - Intergenic
1176386281 21:6139944-6139966 CTGGTGGGGAGGTGACCTGGGGG + Intergenic
1176615657 21:9026756-9026778 CAGGGGTTGAGGGGGCCAGGGGG - Intergenic
1176615661 21:9026764-9026786 CAGGTGGACAGGGGTTGAGGGGG - Intergenic
1176709511 21:10137039-10137061 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1176709515 21:10137047-10137069 CAGGGGTTGAGGGGGCCAGGGGG + Intergenic
1176819634 21:13644108-13644130 CAGCTGGGGTGTGGGCCAGGGGG - Intergenic
1177293202 21:19142223-19142245 GAGGTGGGGTGGGGTCGAGGTGG - Intergenic
1177387994 21:20432721-20432743 AAAGTGGGGAGGGGTCAAGATGG + Intergenic
1178060488 21:28848970-28848992 CAGCTGGGGTGGGGTACTGGCGG - Intergenic
1178893537 21:36540662-36540684 CTGGGGGGCAGGGCTCCAGGTGG + Intronic
1179134467 21:38667567-38667589 GAGGTGGGAAGGGGTGCCGGAGG - Intergenic
1179173719 21:38992237-38992259 GAGGTGGGGAGGGCTTCAGAGGG + Intergenic
1179232644 21:39519155-39519177 CAGTTGGGGAGGGGCTCAGGTGG + Intergenic
1179587686 21:42383937-42383959 CAGAAAGGCAGGGGTCCAGGGGG - Intronic
1179675098 21:42975273-42975295 CGGGTGGGTCGGGGTCCTGGGGG + Intronic
1179737192 21:43398308-43398330 CTGGTGGGGAGGTGACCTGGGGG - Intergenic
1179863670 21:44204558-44204580 CAGATGGGGATGGCTGCAGGGGG + Intergenic
1179912939 21:44459873-44459895 GAGATGGGGAGAGGACCAGGAGG + Exonic
1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG + Intronic
1180094463 21:45549656-45549678 GTGGTGGGGAGGGGGACAGGTGG + Intergenic
1180150292 21:45943830-45943852 GAGGTGGGGAGCACTCCAGGTGG + Intergenic
1180204608 21:46250564-46250586 CAGCTGGGGAGAGGCCCATGTGG + Intronic
1180293424 22:10863411-10863433 CTGGTGGGGGGGGGTCGGGGGGG - Intergenic
1181027516 22:20134423-20134445 TGGGTAGGCAGGGGTCCAGGCGG + Intronic
1181162638 22:20967204-20967226 AGGGAGGGCAGGGGTCCAGGAGG - Intronic
1181440862 22:22934650-22934672 CATGTGTGGAGGGGCCCATGTGG + Intergenic
1181440874 22:22934693-22934715 CATGTGTGGAGGGGCCCATGTGG + Intergenic
1181442392 22:22943347-22943369 CAGGTGGGACGGGGTATAGGAGG + Intergenic
1181552034 22:23645362-23645384 CAGGTGGGGAGGGAAGGAGGGGG - Intergenic
1181808680 22:25390680-25390702 ATGGTGGGGAGGGGTCCCCGGGG - Intronic
1182048096 22:27292142-27292164 GAGGTGGGGAAGCGTCCATGTGG + Intergenic
1182705855 22:32279901-32279923 AAGGTGGGGAGGTGACCTGGGGG + Intergenic
1183101213 22:35585411-35585433 AAGGTGGGGAGGGGCAGAGGAGG - Intergenic
1183322520 22:37173755-37173777 GGGTTGGGGAGGGGTCCTGGAGG + Intronic
1183323897 22:37181050-37181072 CTGGTGGGACGGGGTCCCGGTGG - Exonic
1183369815 22:37426147-37426169 CTGGGTGGGAGGAGTCCAGGGGG + Intronic
1183408705 22:37642667-37642689 CAGCTGGGAGGGGGTCCAGGTGG + Intronic
1183586393 22:38755569-38755591 CAGGCGGGGCGGGGGCCAGGAGG + Intronic
1183616680 22:38950094-38950116 CAGGTGGGAAGGGTTCCACATGG + Intergenic
1183704647 22:39469203-39469225 TGGGTGGGGAGGGGCCCAGAAGG + Intronic
1183864583 22:40694070-40694092 AAGGTGGGGAGGACTCAAGGAGG - Intergenic
1184236887 22:43187390-43187412 GCGGTGGGGAGGGGGGCAGGGGG - Intergenic
1184394187 22:44222971-44222993 AAGGTGGGGAGGTGACCTGGGGG + Intergenic
1184430979 22:44441472-44441494 CAGGTGTGCAGGGCTCCAGGAGG - Intergenic
1184459291 22:44628064-44628086 CAGATGGAGGGGGGTTCAGGAGG - Intergenic
1184595211 22:45509704-45509726 CAGGAGGGGCAGGGTGCAGGTGG + Intronic
1184673230 22:46026706-46026728 CAGGTGGGGAGGGGTGCCGCAGG + Intergenic
1184835338 22:47017584-47017606 CAGGTGGGGAGGGAGTGAGGTGG + Intronic
1184836834 22:47028979-47029001 CAGCTGGGCAGAGGTGCAGGTGG - Intronic
1184948149 22:47818740-47818762 CAGGTGGGGAGACGTCAGGGCGG + Intergenic
1185000728 22:48244095-48244117 CACGTGGGCAGATGTCCAGGAGG + Intergenic
1185140914 22:49100759-49100781 CAGGTGCTGAGGGGCTCAGGAGG + Intergenic
1185284040 22:49992262-49992284 CAGGTGGGGAGAAGTGCAGAAGG - Intergenic
1185330299 22:50249266-50249288 GGGGAGGGGAGGGGCCCAGGGGG + Intronic
1185339821 22:50286298-50286320 CAGAGGGGGAGGTGTCAAGGTGG + Intronic
949461982 3:4303524-4303546 CAGGTAGGGGCGGGGCCAGGCGG + Exonic
949918067 3:8980530-8980552 CAGGGGTGGAGAGGTCCTGGGGG - Intergenic
950137092 3:10589106-10589128 TAGGTGGGGATGGGTCAGGGTGG + Intronic
950795927 3:15510745-15510767 CAGGAGGGGAGGGGAACAGAGGG + Intronic
952726948 3:36596597-36596619 CATGAGGGGAGGGGCCCAGGAGG - Intergenic
952867288 3:37862276-37862298 AAGGTGAGGAGGGGCGCAGGCGG + Exonic
953033701 3:39193608-39193630 CAGGGCGTGAGGGGCCCAGGAGG + Intergenic
953232007 3:41073858-41073880 TTGGTGGGGAGGGGTCCTGTTGG - Intergenic
954410356 3:50367909-50367931 CAGGAGGGGAGGGGTGGGGGTGG + Exonic
954411592 3:50373562-50373584 AAGGTGAGGAGGGAGCCAGGGGG + Intronic
954693748 3:52409822-52409844 CAGGTGAGGAGGGGACCGGGAGG - Exonic
954697292 3:52434708-52434730 GAGCTGGGGAAGGGTGCAGGCGG - Exonic
954864680 3:53718557-53718579 GGGGTGGGGAGGTGTGCAGGAGG - Intronic
955925279 3:63998196-63998218 CAGAAGGGGGGGGGGCCAGGTGG + Intronic
956834824 3:73088328-73088350 GAGGTGGGGACGGGTCCACATGG + Intergenic
960624994 3:119673967-119673989 CAGATGGGGTGGTGGCCAGGCGG - Intronic
961003253 3:123388240-123388262 CAGGTTGGGAGGGGCCGCGGAGG + Intronic
961349816 3:126292679-126292701 CAGTGGGGGAGGTGTCCATGGGG + Intergenic
961577368 3:127848902-127848924 GAGGTAGGGAAGGCTCCAGGAGG + Intergenic
961734936 3:128995407-128995429 CAGGTGGGGTGTGGGCAAGGTGG - Intronic
962212689 3:133492119-133492141 CAGCTGGGGTGGGGTGCTGGTGG - Intergenic
962746714 3:138402311-138402333 TAGGTGGGGAGGGGTCCCGAGGG - Exonic
962948858 3:140199569-140199591 CAGGTGGGCAGGGGCCTGGGCGG - Intronic
963397919 3:144757165-144757187 AAGGTGGGTGGGGGGCCAGGGGG - Intergenic
965429494 3:168568754-168568776 CAGGGGGCCAGGGGGCCAGGGGG - Intergenic
965429499 3:168568762-168568784 CAGGGGGCCAGGGGGCCAGGGGG - Intergenic
965754951 3:172016248-172016270 ATGGTGGGGAGGGGGGCAGGGGG - Intergenic
965894846 3:173563007-173563029 CAGGTGGAGAAGGCTGCAGGTGG - Intronic
965907215 3:173724035-173724057 CAGATGGGTAGGGATCCATGGGG + Intronic
967274978 3:187765559-187765581 CAGGATGTGAGGGGTGCAGGAGG - Intergenic
967824988 3:193870495-193870517 CAGGTGGAGAAGGGTCAAGGTGG + Intergenic
967942102 3:194774004-194774026 CAAGGGGGCATGGGTCCAGGAGG - Intergenic
967994503 3:195156401-195156423 AGGGTGGGGAGGGGTCGTGGAGG + Intronic
968371261 3:198223925-198223947 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
968498332 4:931588-931610 CAGGAGGTGAGCGGTGCAGGAGG - Intronic
968505230 4:968278-968300 CGAGTGGTGCGGGGTCCAGGTGG - Exonic
968613246 4:1566510-1566532 CAGGTGGGTGTGGTTCCAGGTGG + Intergenic
968647851 4:1749111-1749133 CAGGTGGGGAGGGGGCGTGATGG - Intergenic
968647864 4:1749139-1749161 CAGGTGGGGAGGGGTCGTGGTGG - Intergenic
968647885 4:1749183-1749205 CAGGTGGGGAGGGTTCGTGGTGG - Intergenic
968647964 4:1749356-1749378 CAGATGGGGAGGGGGCATGGTGG - Intergenic
968658733 4:1789925-1789947 GAGGTGGGTGGGGGTGCAGGGGG + Intergenic
968750953 4:2388807-2388829 CAGCAGGGGAGGGGTCTGGGTGG - Intronic
968853650 4:3102131-3102153 CAGGTGGGAGGGAGTCCAGGTGG + Intronic
968872879 4:3250433-3250455 CGGGTGGGCAGGGGTCATGGTGG + Intronic
968920269 4:3518807-3518829 CAGGAGGGGTGGGGGGCAGGAGG + Intronic
968926575 4:3551561-3551583 CAGGAGGAGAGGTGTGCAGGGGG - Intergenic
969350779 4:6596834-6596856 CAGGTGGGGTGGGGTGCTGAAGG - Intronic
969497166 4:7532888-7532910 GAGGTGGGGAGGGCTACAGAGGG + Intronic
969623247 4:8289534-8289556 CTGGTGGGGTGGTATCCAGGTGG + Intronic
969696513 4:8738135-8738157 CAGGTGGGGTAGGGGGCAGGGGG - Intergenic
971263317 4:25076528-25076550 CACGTGGGGCAGGGTGCAGGAGG - Intergenic
971422928 4:26490505-26490527 GAGGTGGGGCGGGGTGAAGGTGG - Intergenic
971618457 4:28824159-28824181 GAGGTAGTGGGGGGTCCAGGTGG - Intergenic
973719827 4:53711842-53711864 CAGGAGAGCAGGGGTCCAGAGGG - Intronic
974366393 4:60955149-60955171 GGGGTGTGGAGGGGTGCAGGAGG + Intergenic
975141414 4:70922445-70922467 GAGGTGGGGAGGGGGCTTGGGGG + Intronic
976680143 4:87746538-87746560 CAGGTGGGGAGAAGTTCAGCAGG + Intergenic
977328023 4:95601909-95601931 CATGTTGGGAGGGGTGCATGGGG + Intergenic
978710577 4:111775641-111775663 CAGGAGGGGAGGGGAGGAGGAGG + Intergenic
979328433 4:119404228-119404250 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
980232362 4:130061229-130061251 CAGTTGGGGATGGGTCCAATTGG - Intergenic
982035377 4:151341080-151341102 AGGGTGGGGAGGGGACCAGTGGG - Intergenic
982307974 4:153953585-153953607 CAGGATGGGAGGGGACCGGGAGG - Intergenic
982669111 4:158298962-158298984 CCGGTGGCTAGGGGACCAGGCGG - Intergenic
985496189 5:207772-207794 GAGGTGTGGAGGGGTGGAGGTGG + Intronic
985505527 5:278071-278093 AAGGTGGGGAAGGGAGCAGGTGG - Intronic
985627224 5:995356-995378 CAGGTGGAGAGGGGGCGATGAGG - Intergenic
985864042 5:2497857-2497879 CAAGTGGGGAGGGGGGCAGGTGG + Intergenic
986388327 5:7261284-7261306 CAGGAGGGGAGGGGTACACAGGG + Intergenic
987112462 5:14700675-14700697 AAGGTGGGGAGGGCTGCAGAGGG - Intergenic
989515460 5:42337676-42337698 CAGGTGTTAATGGGTCCAGGGGG - Intergenic
989619335 5:43368998-43369020 GAGGTGGGGTGGGGGGCAGGGGG + Intergenic
990056887 5:51592709-51592731 CAGGTAGAGAGGGGTACAGCTGG + Intergenic
991446274 5:66703141-66703163 CATGTGGGGAGGGGAGTAGGGGG + Intronic
992549656 5:77848519-77848541 GAGGTGGGTAGGGGCACAGGCGG - Intronic
995538881 5:113165043-113165065 CAGATGGGGTGGGGTGCAGGAGG - Intronic
995746318 5:115407589-115407611 CAGCTGGTGAGGCTTCCAGGTGG - Intergenic
996403992 5:123089370-123089392 CAGGTCGGGAGGTTTCCGGGCGG + Exonic
996651336 5:125880489-125880511 CAGATGGGGAGGGTTGCAAGGGG - Intergenic
997193706 5:131963290-131963312 GAGGTGAGGACGGGTCCTGGAGG - Intronic
997286574 5:132683499-132683521 CAGCTGGGGATGTGTACAGGGGG + Intergenic
999024885 5:148217549-148217571 CTGGTGGGGAGGGTTCCAATAGG - Intergenic
999143367 5:149377301-149377323 GGGGTGGGAAGGTGTCCAGGAGG - Intronic
999148483 5:149411244-149411266 CAGGTGATGAGGGGACCAGGCGG + Intergenic
999269487 5:150288590-150288612 CACGGGGGGAGGGGCCCTGGAGG - Intronic
999768593 5:154757786-154757808 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768601 5:154757802-154757824 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768609 5:154757818-154757840 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
999768617 5:154757834-154757856 CAGGGGGGAAGGGGAGCAGGGGG - Intronic
1000009822 5:157220518-157220540 CAGGTGGGAAGAGCTCCACGGGG - Intronic
1000889036 5:166782361-166782383 CTGGTGGGGGGGAGTCCTGGGGG - Intergenic
1001116576 5:168945607-168945629 CATGTGGAGAGGGTTCCAGGCGG - Intronic
1001927938 5:175652665-175652687 GGGGTGGAGAGGGATCCAGGAGG - Intergenic
1002103402 5:176868429-176868451 CAGGTGGCCAGGGGGCCATGGGG - Intronic
1002170404 5:177371292-177371314 CAGGAGGAAGGGGGTCCAGGTGG + Intronic
1002182920 5:177440854-177440876 CTGGTGGGGTGGGCTCCAGGAGG + Intronic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002327056 5:178416475-178416497 CCGGAGGGGTGGGGCCCAGGAGG + Intronic
1002730499 5:181329471-181329493 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1002754030 6:144633-144655 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
1002926633 6:1609210-1609232 CGGCTGGGGAGGGGTCATGGAGG + Intergenic
1003062899 6:2876243-2876265 CAGGTGGGGAGGACTCCCGGTGG + Intergenic
1003094527 6:3131912-3131934 AAGGTGTGGCGGGGTCCAGGAGG - Intronic
1003164136 6:3661467-3661489 CAGGAGTTGAGGGGTCCAGGAGG - Intergenic
1003264029 6:4550396-4550418 CAGGTGGGTGGAGCTCCAGGTGG - Intergenic
1003637333 6:7844715-7844737 CGGGAGGAGAGGGGGCCAGGAGG + Intronic
1005900681 6:30214128-30214150 TTGGTGGGGAGGTTTCCAGGAGG + Intergenic
1006150113 6:31982584-31982606 CAGGAGGGGAGGAGGCCAGTGGG - Intronic
1006156414 6:32015322-32015344 CAGGAGGGGAGGAGGCCAGTGGG - Intronic
1006338277 6:33432111-33432133 AAGTTGGGGAGGGGGCCAGAAGG - Intronic
1006369106 6:33633504-33633526 CAGGTGGGGAGGGGTACCCCGGG + Intronic
1006931642 6:37692419-37692441 AAAGTGGGGAGGGGGGCAGGGGG + Intronic
1006981822 6:38153663-38153685 CAGGTGGGGAAGGGTGGGGGTGG + Exonic
1007076931 6:39074144-39074166 AAGGTGGGGAGGGGATCAAGAGG + Intronic
1007295196 6:40815957-40815979 CAGATGGGGCGGCGGCCAGGCGG - Intergenic
1007358938 6:41341812-41341834 CAGGTCGCGGGGAGTCCAGGAGG - Exonic
1007364726 6:41383424-41383446 CATGTGGGGAGGCGCCCTGGTGG - Intergenic
1007386598 6:41524289-41524311 GAGGAGGGGAGGGGGACAGGAGG + Intergenic
1007391930 6:41554424-41554446 CAGGTGAGGAGGGCACGAGGAGG - Intronic
1007474396 6:42109108-42109130 CAGCAGGGGAGGGGTGCAGCAGG + Intronic
1007702598 6:43773463-43773485 CGGGTGGGGAGGGTTAGAGGAGG + Intronic
1009404106 6:63291501-63291523 AAGGTGGGGAGGAGTTCAGCTGG - Intronic
1011127118 6:84019548-84019570 GAGGTGGGGAGGGGGCGAGGCGG + Intergenic
1012169885 6:96003407-96003429 CAGCTGTGGTGGGGTGCAGGTGG - Intergenic
1013413789 6:109906162-109906184 AAGGTGGGGATGTGTGCAGGGGG + Intergenic
1014278601 6:119416576-119416598 CAGGTGGGGTCAGGGCCAGGTGG + Intergenic
1014453625 6:121611460-121611482 CAGGAGAAGAGGGGACCAGGTGG - Intergenic
1015945155 6:138492211-138492233 CATGTGGGGATGGGAGCAGGAGG + Intronic
1016813294 6:148281474-148281496 CAGACAGGGAGGGCTCCAGGAGG + Intronic
1017019512 6:150129043-150129065 CAGCTGGGGAGGTGTCCTGGGGG + Intergenic
1017456331 6:154604468-154604490 CAGGGAGGCAGGCGTCCAGGTGG - Intergenic
1017809327 6:157973664-157973686 AAGGCTGTGAGGGGTCCAGGAGG - Intergenic
1018719350 6:166561167-166561189 GAGGTGTGTAGGGCTCCAGGGGG - Intronic
1018812603 6:167308550-167308572 CAGGTGGGGTGGGGTGCAGGAGG + Intronic
1018840171 6:167510764-167510786 AAGGAGGGGAGGGGCCCTGGTGG - Intergenic
1019179465 6:170177382-170177404 CCGGTCGGGAGGCATCCAGGGGG + Intergenic
1019375818 7:691402-691424 CTGGTCAGGAGGGGTGCAGGAGG + Intronic
1019541028 7:1551056-1551078 GAGGTGGGGGTGGGTGCAGGAGG + Intronic
1019742522 7:2681959-2681981 CAGCGGAGGAGGGGTCCTGGGGG + Intronic
1020007411 7:4789971-4789993 GAGAGGGGGAGGAGTCCAGGAGG - Intronic
1021330955 7:19339204-19339226 CAGGTGGGAGGGGGTCCCTGGGG + Intergenic
1021521599 7:21543736-21543758 CACGTGGGGAGGAGTCCTGCGGG - Intronic
1022094219 7:27129136-27129158 CAGATGGGGAGGGGTGGATGAGG + Exonic
1022230038 7:28405795-28405817 TAGATGGGCAGGGATCCAGGAGG - Intronic
1022485133 7:30771829-30771851 CAGCTGGGGAGGGGGCCTGGGGG + Intronic
1023017269 7:35980908-35980930 CTGGTGGAGAGAGGTCCATGTGG - Intergenic
1023481187 7:40636369-40636391 GAGGTGGGGAGGGAGTCAGGTGG + Intronic
1024075645 7:45816644-45816666 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1024117175 7:46205536-46205558 CAGGTGGTGACGTGTCCAGGTGG - Intergenic
1024232250 7:47371473-47371495 CAGGTGGGCAGTGGGCCAGCAGG - Intronic
1024233393 7:47379769-47379791 CAGGAGGGGAGGTGCCCAGCAGG + Intronic
1024241607 7:47440260-47440282 CACGTGGAGAGGGGACCAGCTGG + Intronic
1025051804 7:55739152-55739174 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
1025177141 7:56807698-56807720 CAGTTGGGGGGCGGTCCAGTGGG + Intergenic
1025694651 7:63768688-63768710 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1025762263 7:64405629-64405651 CGAGTGGGGAGGGGGCGAGGGGG - Intergenic
1026010096 7:66629364-66629386 TGGGTGGGTAGGGGTGCAGGTGG - Intronic
1026597396 7:71745579-71745601 GAGGTGGGGGGAGCTCCAGGTGG + Intergenic
1026672613 7:72403172-72403194 GGGGTGGCGCGGGGTCCAGGAGG - Intronic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1027136977 7:75631568-75631590 CAGGTAGAGAGGGGTCAGGGTGG - Intronic
1028551714 7:92074860-92074882 TAGGGGGTGAGGGGTACAGGAGG + Intronic
1029382527 7:100222962-100222984 CAGGTAGGAACGGGGCCAGGTGG - Intronic
1029597123 7:101543883-101543905 CAGGTAGGCAGGGCTCCTGGGGG + Intronic
1029946988 7:104543151-104543173 CAGGGGGTGAGGGGTCCAAGGGG + Intronic
1030386653 7:108874973-108874995 CAGGAGGGGAGGGGGCAAGGAGG - Intergenic
1030886890 7:114949792-114949814 AATGTGGGGAGGGGGCCAGAGGG + Intronic
1032052174 7:128656391-128656413 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1032263023 7:130351676-130351698 ATGATGGGGAGGGGTCCAGGAGG + Intronic
1032435325 7:131896094-131896116 CAGCTGCGTAGGGGTGCAGGTGG + Intergenic
1032457143 7:132081837-132081859 CAGGAGGAGAGGGCTCCTGGAGG - Intergenic
1033014072 7:137653721-137653743 CAGCTGGGGAGGTTTCCAAGGGG + Intronic
1033582405 7:142749757-142749779 AAGCTGGGAAGGGGGCCAGGTGG + Intronic
1034418350 7:150976779-150976801 GAGGTGGGGGTGGGCCCAGGGGG - Intronic
1034425236 7:151010519-151010541 CAGTGGGGGAGGGGTCAAGAAGG + Intronic
1034487461 7:151374876-151374898 CACGTGGTGAGGGGTCCCGAGGG + Intronic
1034683809 7:152952145-152952167 GAGGTGGGGAAGGGCCGAGGCGG - Intergenic
1035206917 7:157299938-157299960 CACGTGGGGAGGGTCCCACGTGG - Intergenic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035270185 7:157715198-157715220 CAGGTGGGGAGGGCTGGAGGCGG + Intronic
1035538054 8:407238-407260 CAGGTGGGGACGGGGCCTGTGGG + Intronic
1035716002 8:1755428-1755450 AAGGTGGGGAGGGGTCTGTGTGG - Intergenic
1036204559 8:6795484-6795506 CTGGTGGGGGAGGTTCCAGGGGG - Intergenic
1037319793 8:17631725-17631747 CAGGTGAGGTGGAATCCAGGAGG - Intronic
1037751681 8:21686472-21686494 CAGGTGCTGAGGAGTCCTGGAGG + Intergenic
1037801788 8:22040023-22040045 CTGGGGGGGTGGGGTTCAGGAGG - Intergenic
1038737308 8:30182799-30182821 CAGGGCGGCAGGGGTGCAGGTGG - Intronic
1039424981 8:37478141-37478163 CAGCTGGGAAGTGGCCCAGGAGG + Intergenic
1039506020 8:38052885-38052907 CAGTTGGGGAGGGGTCTGTGAGG - Intronic
1040006838 8:42628148-42628170 CAGGTTGGGAATGGTGCAGGGGG - Intergenic
1040088035 8:43365735-43365757 CAGCTAGGGTGGGGACCAGGGGG - Intergenic
1040111706 8:43569665-43569687 CAGGTGGCCAGGCCTCCAGGGGG - Intergenic
1040850950 8:51899613-51899635 CAGGCAGGGCGGGGCCCAGGCGG - Intergenic
1040928924 8:52714247-52714269 GAGGCAGGGAGGGGTCCGGGCGG + Exonic
1041691818 8:60694715-60694737 GAGGTGGGGAGGGCAACAGGGGG - Intronic
1043165948 8:76902684-76902706 CAGTTGGGGTGGGGGCCAAGAGG - Intergenic
1044666953 8:94641291-94641313 TAGGTGGGGAGGGGGAGAGGGGG - Exonic
1045388475 8:101692640-101692662 TAGGAGGGGAGAGGACCAGGTGG - Intronic
1045431396 8:102118190-102118212 CTGGTGGGGAGGCATCCAGGTGG - Intronic
1047335787 8:123934760-123934782 TTGGGGGGGAGGGGTCCTGGTGG + Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048345393 8:133571542-133571564 GGGGTGGGGAGGGGACTAGGAGG - Intronic
1049047758 8:140166079-140166101 CAGGTGGTGTGGAGTCCAGCTGG + Intronic
1049164184 8:141116469-141116491 CAGGAGGGGTGGAGTCCACGAGG + Intergenic
1049355619 8:142186753-142186775 GAGGTGGGTAGGGAGCCAGGTGG - Intergenic
1049383858 8:142331157-142331179 CAGCTGGGGAGGGGTTCTGGCGG - Intronic
1049476882 8:142801023-142801045 CAGGTGGGGAGGTGCCCAGTGGG + Intergenic
1049674541 8:143883838-143883860 CATGTGGGGAGGGCACCATGTGG - Intergenic
1049749275 8:144275779-144275801 CAGGTTGGCTGGGGGCCAGGCGG - Intronic
1049760841 8:144331422-144331444 GAGGTGGGGAGGAGTGTAGGGGG + Exonic
1049963046 9:754793-754815 CAGGTGGACAGGGATCCTGGAGG + Intergenic
1050290423 9:4148605-4148627 GTGATGGGTAGGGGTCCAGGTGG - Intronic
1051053372 9:12956028-12956050 CAGGTGGGGAGGGGTGAAACCGG - Intergenic
1051557852 9:18404897-18404919 AAGCTGGGGAGGGGTGCATGTGG - Intergenic
1052603519 9:30670925-30670947 CAGGGGTTGAGGGGACCAGGGGG - Intergenic
1052785749 9:32826667-32826689 CTGGAGGGGAGAGGTCAAGGTGG + Intergenic
1052862910 9:33447699-33447721 GAGGTGGGGCGGGGGCGAGGGGG - Intergenic
1052894146 9:33731704-33731726 GAGGTGTGGAGGGGCCCAGGGGG - Intergenic
1053153507 9:35757373-35757395 CAGGTGGGGAGGGATCCCCTGGG + Exonic
1053359852 9:37477086-37477108 AAGGTGGGAAGAGGACCAGGTGG + Intergenic
1053417063 9:37953508-37953530 CAGGTGGGGCTGCCTCCAGGAGG + Intronic
1053646484 9:40122575-40122597 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1053646488 9:40122583-40122605 CAGGGGTTGAGGGGGCCAGGGGG + Intergenic
1053759225 9:41340968-41340990 CAGGGGTTGAGGGGGCCAGGGGG - Intergenic
1053759229 9:41340976-41340998 CAGGTGGACAGGGGTTGAGGGGG - Intergenic
1054143703 9:61547883-61547905 CAGGAGGAGAGGTGTGCAGGGGG + Intergenic
1054327495 9:63720477-63720499 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1054327499 9:63720485-63720507 CAGGGGTTGAGGGGGCCAGGGGG + Intergenic
1054463480 9:65479218-65479240 CAGGAGGAGAGGTGTGCAGGGGG + Intergenic
1054538081 9:66253390-66253412 CAGGGGTTGAGGGGGCCAGGGGG - Intergenic
1054538085 9:66253398-66253420 CAGGTGGACAGGGGTTGAGGGGG - Intergenic
1057211052 9:93201329-93201351 GGAGTGGGGATGGGTCCAGGTGG + Intronic
1057327604 9:94080052-94080074 CAGGTTGGGAGGGCTCCATGTGG + Intronic
1058446813 9:105062214-105062236 CAGGAGGGGAGAGATCCCGGAGG + Intergenic
1058579624 9:106440973-106440995 TAGGTGGGGAGGGTTGCAGTGGG - Intergenic
1058630807 9:106984446-106984468 CTTGTGGGGAGGGGCCAAGGGGG + Intronic
1058868199 9:109180586-109180608 GAGGTGGGAAGGTGTCCAGCAGG - Intronic
1058905991 9:109483144-109483166 AAGGTGTGGAGGGCTCCATGGGG - Intronic
1059282339 9:113145673-113145695 GTGGTGGGGAGGGGTCAGGGAGG - Intergenic
1059350766 9:113663265-113663287 CAGGTGGGGATGGGGTCAGAGGG - Intergenic
1059424196 9:114210647-114210669 CAGGTTGGGAGGGGGCGGGGAGG - Intronic
1059455521 9:114398071-114398093 AGGGAGGGGAGGGGTCCCGGGGG - Intergenic
1059717819 9:116930149-116930171 CAGGTGAGGAGAGCACCAGGTGG + Intronic
1059977814 9:119736766-119736788 CAGGAGGGGAGGGGGGCAGATGG + Intergenic
1060222444 9:121771902-121771924 CAACTGTGGCGGGGTCCAGGGGG - Intronic
1060509653 9:124222637-124222659 CAGGTTGGTAGGGGCACAGGGGG + Intergenic
1060640320 9:125232743-125232765 CAGGTGAGCAGGTGTCCATGGGG + Exonic
1060821010 9:126661658-126661680 CAGGTGGGGAGGGGTGGGCGGGG - Intronic
1060934027 9:127505659-127505681 CAGCAGGGGAGGGGGCCTGGGGG + Exonic
1060941587 9:127545868-127545890 CAGGCGGGGTGGGGGGCAGGAGG - Intronic
1061073274 9:128325202-128325224 CAGATGAGGAGGGATCCAGAGGG + Exonic
1061139005 9:128753098-128753120 CAGGTGGGGAGGAGTAGAGGTGG - Intronic
1061218927 9:129237638-129237660 CAGGTGGGGGGTGGTGGAGGTGG + Intergenic
1061228163 9:129293224-129293246 CAGGTCGGGTGGGGGGCAGGGGG - Intergenic
1061248981 9:129415517-129415539 CAGGTGGTGATGGCTCCTGGAGG + Intergenic
1061491148 9:130944892-130944914 CAGGTGGGGAGGGGAGAAGAGGG + Intergenic
1061804285 9:133129333-133129355 CAGGTGGGGAGTGGGCCCTGCGG + Intronic
1062070153 9:134551061-134551083 CAGGAGGGAAGGGGGCCAGGTGG + Intergenic
1062125163 9:134856302-134856324 CAGGGAGGGAGGGGTTGAGGGGG - Intergenic
1062202203 9:135309480-135309502 CAGGTGGGAAAGGGCCCAGCTGG + Intergenic
1062244216 9:135555642-135555664 GAGGTGGGGAGTGGCCCAGCTGG - Intergenic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245366 9:135563283-135563305 CAGGTGGGTAGGTGGGCAGGTGG + Intronic
1062245375 9:135563331-135563353 CAGGTGGGCAGGTGAGCAGGTGG + Intronic
1062245395 9:135563403-135563425 CAGGTGGGTAGGTGGACAGGTGG + Intronic
1062245417 9:135563491-135563513 CAGGTGGGTAGGTGAACAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062321053 9:135990754-135990776 CAGGAGGGGAGGGGTTAAAGGGG - Intergenic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062390379 9:136331413-136331435 AGGCTGGGGAGGGGGCCAGGTGG + Intronic
1062406160 9:136397634-136397656 CACGTGGGGAGGGGAGCACGTGG + Intronic
1062406166 9:136397650-136397672 CACGTGGGGAGGGGAGCACGTGG + Intronic
1062406172 9:136397666-136397688 CACGTGGGGAGGGGAGCACGTGG + Intronic
1062459496 9:136656944-136656966 CAGGTGGGGAGAGGACAGGGCGG + Intergenic
1062462123 9:136666381-136666403 CAGGTGGGGAGGGAGCCCGTGGG + Intronic
1062464549 9:136675350-136675372 CAGGAAGGGAGGGGGCCAGCAGG + Intronic
1062464565 9:136675391-136675413 CAGGGAGGGAGGGGGCCAGCAGG + Intronic
1062464606 9:136675514-136675536 CAGGGAGGGAGGGGGCCAGCAGG + Intronic
1062464621 9:136675555-136675577 CAGGGAGGGAGGGGGCCAGCAGG + Intronic
1062683875 9:137799920-137799942 CAGGGGGGCTGGGCTCCAGGAGG + Intronic
1062699234 9:137890434-137890456 CAAGTGGGGACTGGACCAGGTGG + Intronic
1062754910 9:138281981-138282003 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1202794270 9_KI270719v1_random:106006-106028 CAGGTGGACAGGGGTTGAGGGGG + Intergenic
1202794274 9_KI270719v1_random:106014-106036 CAGGGGTTGAGGGGGCCAGGGGG + Intergenic
1203527726 Un_GL000213v1:105462-105484 CAGCTGGGGTGTGGGCCAGGGGG + Intergenic
1203578819 Un_KI270745v1:26150-26172 CAGTTGGGGGGCGGTCCAGTGGG - Intergenic
1185519085 X:724848-724870 CAGGTGGGGAGGGTCCCTGCAGG - Intergenic
1185519123 X:725017-725039 CAGGTGGGGAGGGTCCCTGCAGG - Intergenic
1185519142 X:725101-725123 CAGGTGGGGAGGGTCCCTGCAGG - Intergenic
1185519162 X:725185-725207 CAGGTGGGGAGGGTCCCTGCAGG - Intergenic
1185519172 X:725227-725249 CAGGTGGGGAGGGTCCCTGCAGG - Intergenic
1185519183 X:725269-725291 CAGGTGGGGAGGGTCCCTGCAGG - Intergenic
1185519223 X:725437-725459 CAGGTGGGGAGGGTACCTGTAGG - Intergenic
1185608043 X:1378535-1378557 CATATGGGGTGGCGTCCAGGGGG - Intronic
1189398889 X:40647154-40647176 GCGGTGAGGAGGGGCCCAGGAGG + Intronic
1189900242 X:45699118-45699140 CCAGTGGAGAGGGGTCCAGATGG - Intergenic
1190726358 X:53193109-53193131 GTGGTGGGGATGGGTGCAGGGGG + Exonic
1192230939 X:69264516-69264538 CAGGTGGGGAGGGGGGTGGGGGG + Intergenic
1192342826 X:70278182-70278204 GTGGTGGGAAGAGGTCCAGGAGG + Intronic
1194010474 X:88554493-88554515 CAGGTGGGGTGGGAGTCAGGGGG + Intergenic
1195694314 X:107655428-107655450 CAGGGGAAGAGGGGGCCAGGAGG - Intergenic
1196746418 X:119074382-119074404 CAGGTAGATAGGGGTTCAGGAGG + Intergenic
1196950771 X:120874575-120874597 CAGGTAGATAGGGGTTCAGGAGG - Intronic
1199851287 X:151726383-151726405 CATGTGAGGAGGGGTACATGAGG + Intergenic
1200061661 X:153486442-153486464 CGAGTTGGGAGGGGGCCAGGAGG + Intronic
1200111798 X:153744336-153744358 GAGGTGGTGAGGGGCCGAGGGGG - Exonic
1200119363 X:153783194-153783216 CAGGTGGGGAGCGGTGGGGGGGG - Intronic
1200136256 X:153876094-153876116 AAGGTGGGGAGGGGTGCGGATGG - Intronic
1200140959 X:153902742-153902764 CAGGAAGCGAGGAGTCCAGGGGG + Intronic
1201149045 Y:11085411-11085433 CAGGGGTTGAGGGGGCCAGGGGG - Intergenic
1202381442 Y:24278768-24278790 CAGTTGGGGGGTGGTCCAGTGGG - Intergenic
1202489343 Y:25391358-25391380 CAGTTGGGGGGTGGTCCAGTGGG + Intergenic