ID: 1179986357

View in Genome Browser
Species Human (GRCh38)
Location 21:44922820-44922842
Sequence AAATCAACAAGGTCTTGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179986352_1179986357 24 Left 1179986352 21:44922773-44922795 CCATCAGGAATCACAGCACCTGT 0: 1
1: 0
2: 0
3: 23
4: 201
Right 1179986357 21:44922820-44922842 AAATCAACAAGGTCTTGCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 80
1179986351_1179986357 25 Left 1179986351 21:44922772-44922794 CCCATCAGGAATCACAGCACCTG 0: 1
1: 0
2: 0
3: 21
4: 177
Right 1179986357 21:44922820-44922842 AAATCAACAAGGTCTTGCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 80
1179986355_1179986357 6 Left 1179986355 21:44922791-44922813 CCTGTGAATGGGTTACATTTTCT 0: 1
1: 0
2: 2
3: 34
4: 322
Right 1179986357 21:44922820-44922842 AAATCAACAAGGTCTTGCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179986357 Original CRISPR AAATCAACAAGGTCTTGCGT TGG Intronic
903295337 1:22339817-22339839 AAATCAACAAGGTGTGATGTAGG - Intergenic
906729779 1:48071099-48071121 ATACCCACAAGGTCTTGCCTGGG + Intergenic
906835219 1:49075921-49075943 AAATCAACAAACTGTTGGGTAGG + Intronic
915958364 1:160242610-160242632 AAATCACCAAGATCTAGAGTAGG + Intronic
916491193 1:165303927-165303949 AAAACAACAATCTCTGGCGTGGG - Intronic
922149016 1:222980787-222980809 AAAGCAACAAGTTCTTGGCTGGG + Intronic
924951281 1:248886084-248886106 ACATCAACAAGGCCTTTCTTTGG - Intergenic
1065785142 10:29205882-29205904 AAATCAACAAGTTCTGACGCTGG - Intergenic
1075253512 10:120905188-120905210 AAATCAAGAATGTCTTCAGTAGG + Intronic
1077498412 11:2897729-2897751 AAGCCAACAAGGTTTTGCCTGGG - Intronic
1087934286 11:104014081-104014103 AAATTAACAATGTCTCGCATGGG + Intronic
1088510268 11:110566404-110566426 AAATCACCAGCTTCTTGCGTGGG + Intergenic
1100053373 12:90478600-90478622 AAATCAACAAGGTCTATATTCGG + Intergenic
1102329585 12:112017509-112017531 AAATGAAAAAGCTCTTGAGTGGG + Intronic
1103411239 12:120713061-120713083 AAAATAACAAGGACTTGCTTTGG - Intronic
1107226126 13:38049646-38049668 AAATCAAGGAGGTTTTGGGTAGG - Intergenic
1113452181 13:110419038-110419060 AAATTAACTAGGTCTTAGGTTGG + Intronic
1115544706 14:34455235-34455257 AAATCAACAGGGTATGGCGGCGG + Intronic
1117339024 14:54778142-54778164 AAATCAAGAAGGCCTTGAGAAGG - Intronic
1119625075 14:76166902-76166924 AAATCAAATAGGTCTAGAGTTGG + Intronic
1202934454 14_KI270725v1_random:72630-72652 AAATCAATAAGAACTTGTGTGGG + Intergenic
1125856564 15:42955469-42955491 AAATCAATAAAGTCTTGAATAGG + Intronic
1129716594 15:77855575-77855597 AAATCAGCAATGTATTGCTTAGG + Intergenic
1130644921 15:85716024-85716046 AAATCTATAAGGTCATGGGTTGG + Intronic
1133931580 16:10237046-10237068 AAAAAAAAAAGGTCTTGGGTGGG - Intergenic
1134659854 16:15975914-15975936 AAATGGACATGGTCTTGCTTTGG + Intronic
1142951340 17:3483469-3483491 AAATCAAAAACGTCTTTCTTAGG - Intronic
1144266281 17:13572915-13572937 AAATAAGCAAGGTCTTGTGGCGG - Intronic
1151137311 17:71959277-71959299 AAATCAATCAGGTCTGGAGTTGG - Intergenic
1155616851 18:27731725-27731747 AAATCATCCAGGTTTTACGTAGG + Intergenic
1158503544 18:58025582-58025604 AAAAAAACAAGATCTTGCCTAGG - Intergenic
929878272 2:45814931-45814953 AAACCAACAAGGTGTTGGTTTGG + Intronic
933601102 2:84331010-84331032 AGATCAACAAGGTGTTACTTTGG + Intergenic
935154427 2:100470668-100470690 AAATCAAGAAGGTCTGGCGGGGG - Intronic
935671611 2:105561370-105561392 AAATCAACATGGTGTTGTGCAGG - Intergenic
936508967 2:113130463-113130485 AAATGAACAAGGCCATGAGTGGG - Intronic
943560030 2:189450317-189450339 AGAGCAACAAGCTCTTGTGTGGG + Intronic
946537133 2:220643304-220643326 AAATCAACAGAATCTTGGGTTGG + Intergenic
948359146 2:237406243-237406265 AAATGAAAAAGGTTTTGAGTAGG - Intronic
1174911386 20:54611728-54611750 AAAACAAAAAGGAATTGCGTTGG + Intronic
1177560963 21:22753056-22753078 AAAGCAACGAGGACTTGAGTAGG + Intergenic
1178754175 21:35332253-35332275 CAATAAACAAGGTCTTCCATGGG - Intronic
1179986357 21:44922820-44922842 AAATCAACAAGGTCTTGCGTTGG + Intronic
1180278723 22:10671947-10671969 GAATCAACAAGAACTTGTGTGGG + Intergenic
1184736298 22:46399610-46399632 AAATCCACAAGGTCTCTGGTGGG + Intronic
954521130 3:51227625-51227647 AAAACCACAAAGTCTTGTGTTGG + Intronic
954740344 3:52744742-52744764 AAAAAAAAAAGGTCTTGCGCTGG + Intronic
954959925 3:54555169-54555191 AAATAAATAAGGTCTTGGCTGGG - Intronic
957144669 3:76408414-76408436 AAATCTACAAGGTGTTTCATAGG - Intronic
957735302 3:84195009-84195031 AAATTAACAAGATCTTTCATAGG + Intergenic
960275387 3:115723027-115723049 GAATCAACAGGGTCTTTCCTTGG + Intergenic
963964666 3:151352662-151352684 AGATCAGCCAGGTCTTGCCTAGG + Intronic
965904426 3:173686094-173686116 AAAATAACAAGTTCTTGCCTTGG - Intronic
968654905 4:1774250-1774272 AAATCCCCAAGGTCTGGAGTTGG - Intergenic
969199222 4:5589244-5589266 TACTCAAAAAGGTCTTGCCTCGG - Intronic
973658591 4:53078028-53078050 AAATCAACAAAGTCTTATGATGG - Intronic
974092429 4:57325817-57325839 AAATCAATAAGCTCTTGTGAGGG - Intergenic
975053681 4:69899741-69899763 AAATGAACAAGCTCTTCCTTAGG - Intergenic
977788680 4:101071856-101071878 AAATCAAGAAGGTCATCTGTTGG + Intronic
983649038 4:170020543-170020565 GAATCACCTAGGTCCTGCGTAGG - Intronic
986246851 5:6015624-6015646 AAATGAACAATGTCTTGGGGTGG + Intergenic
988186964 5:27877375-27877397 AAATCTACATGCTCTTGGGTTGG - Intergenic
997813395 5:136993851-136993873 AATTCAATCAGGTCCTGCGTTGG - Intronic
1008096341 6:47343199-47343221 AAATTAACAAGCTCTGGAGTTGG - Intergenic
1010481207 6:76356487-76356509 ACATAAAAAAGGTCCTGCGTAGG - Intergenic
1018050380 6:160004330-160004352 AAATCACCATGGGCTTGCTTGGG + Intronic
1018394537 6:163367707-163367729 GAATCAACAAGTCCTTGGGTTGG - Intergenic
1021263571 7:18490661-18490683 AGATAAATAAGGTCTTGAGTTGG + Intronic
1023086749 7:36578427-36578449 AAATCAACAAAGACTTGAGGTGG + Intronic
1024647714 7:51383678-51383700 AAAGCAACAAGGGCTTTGGTGGG + Intergenic
1031909773 7:127503503-127503525 AAAACAATAATGTCTTCCGTGGG - Intergenic
1035785230 8:2254608-2254630 AAATCAACAAGGTTTTCCCCAGG + Intergenic
1035807578 8:2467108-2467130 AAATCAACAAGGTTTTCCCCAGG - Intergenic
1037023221 8:13999838-13999860 AAATCAACCAGGTGTTGTGGTGG - Intergenic
1040066320 8:43147493-43147515 AAAGCAACAAGGTCTAGAATAGG - Intronic
1042011512 8:64250723-64250745 AAATCCAAAAGGTCTTGCATTGG - Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1050225397 9:3448955-3448977 AAACCAACAAGGTGTAGCATAGG - Intronic
1056525810 9:87441965-87441987 AAAAAAACAAGGTCTTGCCCAGG - Intergenic
1058760463 9:108126193-108126215 AACTCAACAAGAGCCTGCGTTGG - Intergenic
1062005200 9:134235405-134235427 AAATCCACACGGTCATGCCTGGG + Intergenic
1186108993 X:6236261-6236283 AAAAGAACAAGGTATTGCATGGG - Intergenic
1201275422 Y:12292822-12292844 AAATCAGCAAGTTCTGGCATGGG - Intergenic