ID: 1179986529

View in Genome Browser
Species Human (GRCh38)
Location 21:44924840-44924862
Sequence TCTGAAAAGCAAAATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 1, 2: 1, 3: 59, 4: 534}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179986527_1179986529 3 Left 1179986527 21:44924814-44924836 CCACAGATCCGTAACACTGAGAT 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG 0: 1
1: 1
2: 1
3: 59
4: 534
1179986525_1179986529 12 Left 1179986525 21:44924805-44924827 CCTCGTGACCCACAGATCCGTAA 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG 0: 1
1: 1
2: 1
3: 59
4: 534
1179986526_1179986529 4 Left 1179986526 21:44924813-44924835 CCCACAGATCCGTAACACTGAGA 0: 1
1: 0
2: 1
3: 9
4: 67
Right 1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG 0: 1
1: 1
2: 1
3: 59
4: 534
1179986528_1179986529 -5 Left 1179986528 21:44924822-44924844 CCGTAACACTGAGATTCTTCTGA 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG 0: 1
1: 1
2: 1
3: 59
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179986529 Original CRISPR TCTGAAAAGCAAAATGTAGA AGG Intronic
900684068 1:3936091-3936113 TCTGAAAAGTAAATTGCAGCAGG - Intergenic
903683121 1:25110902-25110924 TCTTAAAAAAAAAATGTAAAAGG - Intergenic
906398494 1:45487656-45487678 TATAAGAAGCAAAATCTAGAGGG - Intronic
907601837 1:55779690-55779712 TCTGAACAGAAAAAGGCAGAGGG - Intergenic
907871786 1:58450175-58450197 TCTGAAAAGCAAATGATAGTGGG + Intronic
908134849 1:61120683-61120705 TCCAAAATGCAAACTGTAGAAGG - Intronic
908530291 1:65027562-65027584 TGTGAAAGGCAAAAGGAAGAGGG + Intergenic
908621800 1:65989944-65989966 TCTGAAAAAAAAAATGTTTAAGG - Intronic
909110892 1:71476070-71476092 TCTTTAAAGAAAAATGTAGAAGG - Intronic
909115130 1:71523914-71523936 ACAGAAAAGCAAAAATTAGAGGG + Intronic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
910948750 1:92621746-92621768 TCTGATAAACAACATATAGATGG - Intronic
911390856 1:97240250-97240272 TTTGAGAAGCAAAATGTCCATGG + Intronic
911472460 1:98335092-98335114 TGTCAAAAGCAAAATCTATATGG + Intergenic
912465522 1:109870474-109870496 TCTGGAAAGGAAAATGTGGTGGG - Intergenic
913764523 1:122174052-122174074 TCTGAAAAGTAAATTGCAGCAGG - Intergenic
914909737 1:151775166-151775188 TCTGAGAAGAAAAATGAAAAGGG + Exonic
915053085 1:153096871-153096893 TCTGAATCGCAAAATGTTAAAGG - Intronic
915672407 1:157501180-157501202 TGTGAATAGCAAAATGTCCAGGG - Intergenic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
916051863 1:161042060-161042082 TCTGAGAAGTAAGATGAAGAAGG - Intronic
916457452 1:164985582-164985604 TCTCAAGAGCAAAATAGAGATGG + Intergenic
917249427 1:173041488-173041510 TCTAAAATCCAAAATGTAGGAGG - Exonic
917635724 1:176933960-176933982 TCTCAAAATCAAAATGTTTAGGG - Intronic
917826663 1:178829210-178829232 TCATAGAAGCAAAAAGTAGAAGG + Intronic
918175239 1:182038038-182038060 TCTGAATAACAAAATGTCCAGGG + Intergenic
919011443 1:191970366-191970388 GCTGAAAATTAAAGTGTAGAAGG + Intergenic
919074673 1:192798676-192798698 TCTGAAAAGAAATATCTTGAAGG + Intergenic
920964457 1:210690565-210690587 ACTGAAAAACAAACTGCAGATGG + Intronic
921403274 1:214750393-214750415 TTTGAAAAGTAAAATGCAGAAGG - Intergenic
921518279 1:216125471-216125493 TCTAAAGAGCAAAATGAAGGAGG + Intronic
922085598 1:222344028-222344050 TCTGAAGAGCAAACTGGAGGAGG + Intergenic
923029928 1:230240969-230240991 TCTTAGTAGCAAAATGGAGATGG - Intronic
923521671 1:234739632-234739654 TCTGTACAGCAAAAGGGAGATGG - Intergenic
923833830 1:237587590-237587612 TTTGAAAACCAAAATGTCAAAGG + Intronic
924082163 1:240410159-240410181 TCTGAAAAAAAAAAAATAGAAGG + Intronic
924778702 1:247128797-247128819 CCTGAAAAGCAAAATGCATTTGG + Intronic
924782952 1:247169621-247169643 CCTGAAAAGCAAAATGCATTTGG - Intronic
1063419378 10:5899087-5899109 TTCCAAAAGCCAAATGTAGAAGG + Intronic
1064913584 10:20431074-20431096 TCTGAATAGAAAAATCTAGTAGG - Intergenic
1065256775 10:23877617-23877639 TCTGACAGGCAAAATTTATATGG - Intronic
1066200471 10:33139150-33139172 TCTGAAAACCAAGCTGTTGATGG - Intergenic
1066972511 10:42325295-42325317 TCTGTAAATCAAAAAGAAGATGG - Intergenic
1067333662 10:45344450-45344472 TATTCAAAGCAATATGTAGAAGG + Intergenic
1068153746 10:53169061-53169083 TCTAATGAGCAAAATGTTGAAGG + Intergenic
1068782852 10:60940485-60940507 TCTGAAAGGCACCACGTAGATGG - Intronic
1069197629 10:65572322-65572344 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1071188237 10:83069149-83069171 TCTTAGAAGAAAAATTTAGAAGG + Intergenic
1071235776 10:83646603-83646625 TCTAAAAAACAAAAAGGAGAGGG + Intergenic
1071774822 10:88774416-88774438 TCTGAAAGGCAAAATTTTGTTGG + Intronic
1071926292 10:90413742-90413764 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1072043375 10:91630866-91630888 TCTGGAATGCAAAAAGAAGAGGG + Exonic
1073494190 10:103876542-103876564 TCTCAAAAAAAAAAAGTAGATGG - Intergenic
1073574426 10:104610346-104610368 TATGAATAGCAAAATGTCCAGGG - Intergenic
1076079141 10:127562351-127562373 TCTGAAATCCAAAATATTGATGG + Intergenic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1078176212 11:8973207-8973229 TCTGAAAAGCAAGAGGTAGTAGG - Intergenic
1078450906 11:11440170-11440192 TCTGCTATGTAAAATGTAGACGG + Intronic
1079259714 11:18866720-18866742 ACTGAAAAGGAAAATGGATATGG - Intergenic
1079570892 11:21942259-21942281 TCTGAAAAGTAAAAAGAAGAAGG - Intergenic
1079743329 11:24092734-24092756 TATAAAAAGCAAAATGAAGAGGG + Intergenic
1080074783 11:28136109-28136131 TGTGAATAGCAAAATGTCCAGGG + Intronic
1080313649 11:30923995-30924017 TCTGAAGAGTAACATGAAGATGG - Intronic
1080783991 11:35458076-35458098 CCTGAAAAGAAAAAGGTAGCTGG - Intronic
1081129474 11:39360770-39360792 TCTGAAATGCAACACGTAGTAGG - Intergenic
1081185012 11:40031554-40031576 ACTGAAAAGAAAAATGTATGAGG + Intergenic
1081190934 11:40102332-40102354 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1081928107 11:46847578-46847600 TATGCAAAGAAAAATGTACAAGG + Intergenic
1082274548 11:50207391-50207413 TCTGAAAATTGAAATGAAGATGG + Intergenic
1082656126 11:55859082-55859104 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1082699117 11:56406189-56406211 ACTCAAAAGCAAGATGTAGTGGG + Intergenic
1082900581 11:58246308-58246330 TCAAAAAGTCAAAATGTAGAGGG - Intergenic
1083915411 11:65740024-65740046 TTTATCAAGCAAAATGTAGAAGG + Intergenic
1084365746 11:68696727-68696749 ACTAAATAGCAGAATGTAGAGGG + Intergenic
1085657928 11:78333613-78333635 ACTGAAAAACAAAATGTAGGTGG + Intronic
1085950890 11:81329991-81330013 TCTGTCAAGCAAAAAGTAAATGG - Intergenic
1086166933 11:83790229-83790251 TATGAACAGCCAAATGTGGAAGG - Intronic
1086235121 11:84621062-84621084 TGAGAAAAGCAAATTGCAGAAGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1086805886 11:91241381-91241403 TCTGAAATGCCAAATTTAGATGG + Intergenic
1087234678 11:95704926-95704948 TCTGAAAAACAAAATGTCACAGG + Intergenic
1087432098 11:98067771-98067793 TGTGAAGAGCAAAATGTCCAGGG + Intergenic
1087449900 11:98307533-98307555 TCTGAAAAGTAAAATAAAAAAGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088117626 11:106330581-106330603 TCTTGAAAACAAAATGAAGATGG + Intergenic
1088323628 11:108579660-108579682 TCTGATAAGTAAATTGTAGTAGG + Intronic
1088419393 11:109625769-109625791 TCTGAAAAGCAAAACCTGAAAGG + Intergenic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089813225 11:121148472-121148494 TCTGAGATTCAAAATGTAAAAGG - Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1091133839 11:133170152-133170174 TCTGAAAAGTAAATCATAGATGG - Intronic
1091924373 12:4332817-4332839 TTTGAAAAACAAAATCAAGAAGG - Intronic
1091927704 12:4369454-4369476 TTTGAAAAGCAAATTCTAGCAGG + Exonic
1092292325 12:7168990-7169012 TTTTTAAAGCAAAATGTAAAAGG - Intergenic
1092585949 12:9901342-9901364 TGTGAATAGCAAAATGTCCAGGG + Intronic
1092889739 12:12957821-12957843 TCTAAAAAGGAAAAAGTACATGG + Intergenic
1093883113 12:24428458-24428480 TTTTAAAAGAAAAATGTAAATGG - Intergenic
1094083379 12:26562552-26562574 TTTGCAAGGCAAAATGAAGATGG + Intronic
1094799740 12:34019269-34019291 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095112529 12:38313588-38313610 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095576775 12:43749385-43749407 TCTGATAAAGAAAATGTAGCTGG + Intronic
1096077092 12:48812715-48812737 TCTGCAGAGCAAGATGGAGAAGG + Intergenic
1096517669 12:52166043-52166065 ACTGAAACACAAAATGTAGGTGG - Intergenic
1096666549 12:53170126-53170148 TCTGAAAAAGAAAATGCAGAGGG + Exonic
1096922996 12:55109762-55109784 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1097013634 12:55970335-55970357 TCTGAAAAGCCAGAGGTTGAAGG - Intronic
1097500029 12:60390345-60390367 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1098394238 12:70001699-70001721 CCTGAAAAACAAAATGGTGAAGG - Intergenic
1099224470 12:79952877-79952899 TGTTAAAAGCAAAATATATAAGG - Intergenic
1099688234 12:85916837-85916859 TCTGATAAGCAAAGTTTAAAAGG + Intergenic
1099752327 12:86791815-86791837 TCTGAAAAGAAACATCCAGATGG + Intronic
1099759823 12:86905101-86905123 ACTGAGAACCAAAATGTAAAAGG + Intergenic
1099936061 12:89127102-89127124 TCTGAAATGTACAATGAAGAAGG + Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1100643444 12:96504888-96504910 TATGAAAAGCAAAAAGCAGAAGG - Intronic
1100723851 12:97387547-97387569 TCTGAAATTCAAAATGAAGTAGG - Intergenic
1100769549 12:97906468-97906490 TCTTAACTGAAAAATGTAGATGG - Intergenic
1100813092 12:98359868-98359890 TCTAAAAAGCAAAATTTATCAGG + Intergenic
1101082936 12:101207841-101207863 TGTGAAAGGCAAAATGGACAGGG - Intronic
1101397426 12:104360576-104360598 TCTGAAAAACAAGATTTAAATGG - Intergenic
1101576853 12:106005395-106005417 ACTGAAAAGTAAAATTTACATGG + Intergenic
1102452528 12:113052560-113052582 TCTGCACAGAAGAATGTAGAGGG + Intergenic
1104046019 12:125163585-125163607 TTTGAAAAACAAAAAGAAGAAGG + Intergenic
1104233981 12:126913970-126913992 TCTGCAAACCAAAATGTATGGGG - Intergenic
1105228078 13:18456579-18456601 TCTGTAAATCAAAAAGAAGATGG - Intergenic
1105389352 13:19959727-19959749 TGTGAAAGGCAAAATCTGGAAGG - Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1105832486 13:24176485-24176507 TCTGAAAAGCAGAAATTAAAAGG - Intronic
1106265360 13:28104907-28104929 TCTCAAAAACATAATGTTGAGGG + Intergenic
1106563064 13:30863266-30863288 TTTGAAAAGCACATTGTAGGGGG - Intergenic
1106827202 13:33536648-33536670 TCTGAAAAGCAGAATTAAAAGGG + Intergenic
1106963184 13:35025784-35025806 TGTAAAAAACAAAATGAAGATGG - Intronic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1107299111 13:38947072-38947094 TGTGAAAAGCAAAGTGCAGATGG - Intergenic
1107896039 13:44964899-44964921 TCTTAAAAGCAAGATCCAGAAGG + Intronic
1109012780 13:56972411-56972433 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1109389015 13:61669260-61669282 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1109745194 13:66615484-66615506 TATGAATAGCAAAATGTCCAGGG - Intronic
1109865528 13:68258889-68258911 TGTGAATAGCAAAATGTTCAGGG - Intergenic
1109953826 13:69539177-69539199 TCTGAATAGAAAAATGTCGGTGG - Intergenic
1110256812 13:73442221-73442243 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1110481050 13:75976714-75976736 TCTGAAAAGCAGAACATAGCTGG - Intergenic
1110951923 13:81504348-81504370 TCTCAAAAGAAAAATGTTCATGG + Intergenic
1110990887 13:82040944-82040966 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1111132718 13:83997773-83997795 TATGAATAGCAAAATGTCCAGGG - Intergenic
1111464196 13:88586776-88586798 TGTGAAATGCAAATTCTAGAGGG - Intergenic
1111876751 13:93906649-93906671 TAAGAAATACAAAATGTAGAGGG + Intronic
1112972782 13:105281453-105281475 TCTAAAAAACAAAAAGTTGATGG - Intergenic
1113080174 13:106511149-106511171 TCTGAAATGAAACAGGTAGATGG - Intronic
1113983069 13:114292788-114292810 TTTTTAAAGGAAAATGTAGAGGG - Intronic
1114931221 14:27469845-27469867 TGTGAAAAAAAAAATGTCGATGG - Intergenic
1115089728 14:29559335-29559357 TCTGAAAAACAGAATGTATCAGG + Intergenic
1115116064 14:29881539-29881561 AATAAAAAGCAAAATGGAGAAGG - Intronic
1115367488 14:32574795-32574817 TCAGAAAAGCAGAATTTAGATGG - Intronic
1116264709 14:42673474-42673496 TTTGAAAAACAAAATGTACCAGG + Intergenic
1116654367 14:47632499-47632521 TGTAAAAAGCAAACTGTAAAAGG + Intronic
1117385051 14:55203122-55203144 TCTCAAAAGGAACATGTAGTGGG - Intergenic
1118550305 14:66942504-66942526 TCTGAATAACAAAATGTCCAGGG + Intronic
1119057137 14:71434324-71434346 TCTTATTAGCAATATGTAGAAGG + Intronic
1119297804 14:73547377-73547399 TCTCAAAAACAAAATAGAGATGG + Intronic
1119377779 14:74208602-74208624 TCAGAAGAGCAAAACGAAGAAGG + Intergenic
1119462852 14:74824264-74824286 TCCGAAAAGCAAATGGGAGATGG + Exonic
1119462946 14:74825957-74825979 TCTGAGAAGCAAATGGTAGACGG - Intronic
1119689415 14:76659400-76659422 GCTGAAAACCAAAATGTGGGAGG + Intergenic
1120419927 14:84271542-84271564 TCTGAAAAGCATATTGTAGGAGG + Intergenic
1120935342 14:89890515-89890537 TTTGGAAAGCAGAATTTAGAAGG + Intronic
1121230339 14:92352923-92352945 TCTGAAAAGCAGAATGTTGGGGG - Intronic
1123885610 15:24725192-24725214 GCAGAAAAGGAAAATGAAGATGG - Intergenic
1124105724 15:26736127-26736149 GCTGAAAAGCATTATGGAGAAGG + Intronic
1124384998 15:29200176-29200198 TCTCAAAAAAAAAATGTATATGG - Intronic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1124904168 15:33853023-33853045 TCTGAAAAACAAAACGAAAAAGG - Exonic
1125034161 15:35104561-35104583 TCTGACAAGCAGCATGTAGTAGG + Intergenic
1126548960 15:49906555-49906577 TCTGCAGAGCCAAATATAGAAGG + Intronic
1127487635 15:59434167-59434189 TTTGAAAAGGAAAATGGATATGG + Intronic
1127575123 15:60284470-60284492 TCTGAGGAGCATAAGGTAGAAGG + Intergenic
1127985831 15:64069674-64069696 TCTCAAAAGCAAAAACAAGAAGG + Intronic
1128003828 15:64219458-64219480 TCTCAAAAGAAAAAAGGAGAGGG - Intronic
1128040001 15:64563612-64563634 TATGAAAAACAAAATTTAGCCGG + Intronic
1129148452 15:73671009-73671031 CCTGAGAAACAAAAGGTAGATGG - Intergenic
1131494640 15:92895409-92895431 ACTGGAAAGGAACATGTAGAGGG + Intronic
1131608992 15:93941151-93941173 ACTGAAATGCAAAATGTAAATGG - Intergenic
1131619069 15:94047834-94047856 TCTACAAAGCATAATGGAGATGG + Intergenic
1131977270 15:97959756-97959778 GTTGAAAAGGAAAATGTAGCAGG + Intergenic
1132707666 16:1253571-1253593 GCTGAAAAGCAAAGCGCAGACGG - Intergenic
1132813454 16:1813712-1813734 TCTGAAAACGGAAATGTAAAAGG + Intronic
1133477239 16:6135201-6135223 CCTAAACAGCAAAATATAGATGG + Intronic
1133981859 16:10638936-10638958 TCTAAAATGGAAAAGGTAGACGG - Intronic
1134417529 16:14057462-14057484 TGTGAAAAGGAAAATAAAGATGG - Intergenic
1134421541 16:14095761-14095783 TCTGAAAAACAAAAAAGAGAAGG + Intronic
1135077407 16:19405601-19405623 TGTGAAGAGCAAAATGTCCAGGG + Intergenic
1137313979 16:47297332-47297354 TCTTATAAGCAGCATGTAGATGG + Intronic
1137940185 16:52676478-52676500 TCTAAAAAGGAAAATGCACAAGG + Intergenic
1138214507 16:55191482-55191504 TCTGATCAGCATATTGTAGAAGG + Intergenic
1138545936 16:57719669-57719691 TCTGAAAAACAAAAATTAGCTGG - Intronic
1139961160 16:70718255-70718277 TCTTAAAAGAGAAATGCAGACGG - Intronic
1140289192 16:73634981-73635003 TTTGGAAAGCAAAAAGCAGATGG - Intergenic
1141548445 16:84787931-84787953 TAATAAAAGGAAAATGTAGAGGG + Intergenic
1142422940 16:89983892-89983914 TCTGAAAAAAAAAATCTAAAAGG - Intergenic
1143938638 17:10514217-10514239 GCTGAAAAGAAAGATGTAAAAGG - Intronic
1143957658 17:10685640-10685662 TCTGAAAAGCAAAAGATGAAAGG - Intronic
1147154124 17:38534810-38534832 TCATAAAAGGGAAATGTAGATGG - Intronic
1148120216 17:45205026-45205048 TCTGAAAAAAAAAATGCACATGG - Intergenic
1149263731 17:54905407-54905429 TCTGAAAAGCAACATGCATTTGG - Intronic
1149670884 17:58408995-58409017 TCTGTAAAGAAAAATGAAGCAGG + Intronic
1149852006 17:60043255-60043277 TCAGAAAAAAAAAATGTAGAAGG - Exonic
1151176202 17:72290217-72290239 TCTGAAATGAAAAATATAGCAGG + Intergenic
1152560629 17:81077039-81077061 GGAGAAAAGCCAAATGTAGAGGG + Intronic
1153675257 18:7451332-7451354 CCTGAAAACCAAAATGCAGCAGG + Intergenic
1153691540 18:7599657-7599679 TCTGGAATGAAAAATGTAGCAGG - Intronic
1154384699 18:13882460-13882482 TCTAAGAAACAAAATGAAGATGG - Exonic
1154525303 18:15282896-15282918 TCTGTAAATCAAAAAGAAGATGG + Intergenic
1155456426 18:26019939-26019961 TCTGAAAAAAATAGTGTAGAGGG + Intronic
1155475170 18:26230508-26230530 TCTGAAAATCAAACAGTGGATGG - Intronic
1156060352 18:33066616-33066638 TCTGAAAAGACACATGTAAATGG + Intronic
1157130364 18:45001718-45001740 CCTGCAAAGCAAAAAGGAGAAGG - Intronic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1158608187 18:58914787-58914809 TTTGAAAATCAAACTGTTGAGGG + Intronic
1158641094 18:59204535-59204557 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1158838638 18:61359202-61359224 TAGGGAATGCAAAATGTAGATGG - Intronic
1159681008 18:71352038-71352060 CCTGAAATTCAAAATTTAGATGG + Intergenic
1160409231 18:78663876-78663898 TGTCAAAGGCTAAATGTAGAGGG + Intergenic
1160608431 18:80069491-80069513 ATTGCAAAGCAAAATGTAGATGG + Intronic
1160672174 19:370847-370869 TCGGAAAAGCAAAAGGTACAGGG + Intronic
1161338158 19:3725758-3725780 CCTGAAAAGCAAAAAGCAGAAGG - Intronic
1162618486 19:11820911-11820933 CCTGCAAAGCAAAATATACATGG + Intronic
1163640161 19:18457483-18457505 TCTGGAAAGCAGAATGAAGTTGG - Intronic
1164339593 19:24376301-24376323 GGTGAAAAACAAAATGTAGTAGG + Intergenic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1166418739 19:42616836-42616858 TGTGAATAGCAAAATGTCCAGGG - Intronic
1167141351 19:47652938-47652960 ATGGAAAAGTAAAATGTAGAAGG - Intronic
1167864862 19:52316524-52316546 TCTGAAAAACAAAAAGAAGCTGG - Intronic
926212163 2:10879104-10879126 TCTGAAAAGTAAAATGGTTATGG + Intergenic
926804403 2:16692566-16692588 TTTGAAAAGCAAACTGAACAGGG - Intergenic
926812464 2:16767816-16767838 TTTGAAAGTCAAAATGAAGAAGG - Intergenic
926938519 2:18111570-18111592 TTTGAAAACCAAAATGGTGAAGG + Intronic
926944578 2:18172848-18172870 CCAGAGAAGCTAAATGTAGAGGG + Intronic
927065961 2:19471373-19471395 TCTTAAAAGAAATATGAAGATGG - Intergenic
927133767 2:20081901-20081923 TCTGAAAAGCAAATTTAACAGGG + Intergenic
927221787 2:20717679-20717701 TCAGAAATTCAAAATGTAGGGGG + Intronic
927372346 2:22371040-22371062 TTTGAAAAGTAAACTGAAGAAGG + Intergenic
928550271 2:32363468-32363490 ACAAAAAAGCAAAATCTAGATGG - Intronic
929146358 2:38710046-38710068 TCTGAAAAGCAAAAGTTGGGAGG - Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
930376284 2:50571253-50571275 TCAGAAAAGTAAAATATAAATGG + Intronic
931106249 2:59059531-59059553 TGTGAAATGCAAAATGTCCAAGG - Intergenic
931369913 2:61652573-61652595 TCTGGAAAACAAAATGTTAAAGG + Intergenic
931633445 2:64321687-64321709 TCTAAAAATCATAATTTAGAAGG - Intergenic
932136926 2:69239549-69239571 TCTCAAAAAAAAAATGTTGATGG + Intronic
932661199 2:73654025-73654047 TCAGAAAAGCCAAAAGTAAAAGG - Intergenic
932818299 2:74878990-74879012 CCTGAAATGCAAAATGGAGCTGG - Intronic
932878088 2:75474194-75474216 TACGAAAAGCAAAAAGTATATGG + Intronic
933131169 2:78675597-78675619 TGTGAATAGCAAAATGTCCAGGG + Intergenic
933515342 2:83293578-83293600 TCTGAAAAGCAAAAAAGAAAAGG - Intergenic
933524876 2:83424016-83424038 TCACAAAAGCAAAATGATGAGGG - Intergenic
935284129 2:101548836-101548858 TCTTAAAAGCAAAATCTGAAAGG - Intergenic
935976737 2:108585804-108585826 TCTTAAAAGCCAAATCCAGAAGG - Intronic
936618587 2:114072839-114072861 TTTGAGAGGCAAAATGGAGAAGG - Intergenic
936957452 2:118037206-118037228 TCTGAAAAATAAAATGTAAGTGG + Intergenic
938524488 2:132115019-132115041 TCTGTAAATCAAAAAGAAGATGG + Intergenic
939417085 2:141913746-141913768 TCTTAAAAAAAAAATGTAGGAGG - Intronic
940268077 2:151861268-151861290 TTTGATAATCAAAATGAAGAGGG - Intronic
940502781 2:154515128-154515150 TAGGAAACACAAAATGTAGAAGG - Intergenic
940736107 2:157454078-157454100 TCTGAAAACAAAAGTGGAGAAGG - Intronic
940966331 2:159840821-159840843 TCTGAAAAGTAACATGCAGCTGG - Exonic
941017226 2:160371296-160371318 TTTGAGAGGCAAAATGTAGAAGG - Intronic
942033135 2:171983692-171983714 TCTTAGAAGCAAAGTGTGGAAGG - Intronic
942064714 2:172259864-172259886 TCTGAAAGGTAAAAGGCAGAAGG + Intergenic
942097237 2:172545350-172545372 TCTGAATAACAAAATGTCCAGGG - Intergenic
942802066 2:179887221-179887243 TCAGAACAGAAATATGTAGAGGG - Intergenic
943552635 2:189358847-189358869 TCTGAAAAAAAAAATCAAGAAGG - Intergenic
943878602 2:193108280-193108302 TCTAAAAAGGAAAAAGTAGTTGG - Intergenic
945125622 2:206506403-206506425 GCTGAAAAGTGAAATGTAGTGGG + Intronic
945576003 2:211529812-211529834 CCTGAAAAACTAAGTGTAGAAGG + Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
948189333 2:236045920-236045942 TCTGAAACCCAAAATGTTGCAGG - Intronic
948571957 2:238923213-238923235 TCTAAAAAGCATAATGTGGCTGG + Intergenic
948917641 2:241044462-241044484 TCTGAAAAGTAAATAGTAGCAGG + Intronic
1168908638 20:1427332-1427354 TCTGAAAAGTAAATGGTAGAAGG + Intergenic
1169309726 20:4525391-4525413 TCTGAAAAGCAAATAGCAGCAGG + Intergenic
1170099914 20:12687571-12687593 TATGAAAAGCAAAACAGAGAAGG - Intergenic
1170842687 20:19936730-19936752 TCTGAAAAGGAAAAGATGGAAGG - Intronic
1171389300 20:24790870-24790892 TCTGAAAAGGAAGCTGTAGTTGG + Intergenic
1171723355 20:28589617-28589639 TCTGAATAGAAAAATGGACAAGG - Intergenic
1171754701 20:29093467-29093489 TCTGAATAGAAAAATGGACAAGG + Intergenic
1171787953 20:29489074-29489096 TCTGAATAGAAAAATGGACAAGG - Intergenic
1171859987 20:30390329-30390351 TCTGAATAGAAAAATGGACAAGG + Intronic
1171985120 20:31654809-31654831 CCTGGAAAACAAACTGTAGAGGG - Intergenic
1173092571 20:39987360-39987382 TGTTAAAGGCAAAATATAGATGG + Intergenic
1173345515 20:42196108-42196130 TCTTAAAAGCAAAATGATTATGG - Intronic
1173755961 20:45516259-45516281 TATCAAAAGCACCATGTAGAAGG + Intergenic
1174411266 20:50338089-50338111 TCTGTAAGGCAAAATGGAGCAGG + Intergenic
1176677439 21:9792642-9792664 TCTGAAAAGCAAAAATGACATGG + Intergenic
1176772126 21:13085594-13085616 TCTGTAAATCAAAAAGAAGATGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177665394 21:24150476-24150498 TCTTATAAGCAAAATGGTGATGG - Intergenic
1177823233 21:26054859-26054881 TCTGAAATGCAACATAAAGAGGG + Intronic
1178563653 21:33662842-33662864 TGTGAAAAACAAATTTTAGATGG - Intronic
1178925214 21:36769022-36769044 TCTGTAAATAAACATGTAGACGG + Intronic
1178930495 21:36814479-36814501 TCTGAAACTCAAAATGAACAGGG + Intronic
1179228521 21:39478569-39478591 TCTGAAAAACAAAATGTTAGAGG + Intronic
1179299517 21:40094048-40094070 GCTGCAGAGAAAAATGTAGATGG - Intronic
1179770428 21:43611446-43611468 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1179837148 21:44043566-44043588 TGTGGAAGGGAAAATGTAGATGG - Intronic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1180133214 21:45841407-45841429 TCTGAAAAAAAAAATCTAGTTGG + Intronic
1180296908 22:10948274-10948296 TCTGAATAGAAAAATGGACAAGG - Intergenic
1181019745 22:20093401-20093423 TCTAAAAAAAAAAAAGTAGAAGG + Intronic
1181710800 22:24686822-24686844 TTTGAAAAGAAAGATGGAGAGGG + Intergenic
1184076222 22:42180235-42180257 TCTGAAAAGGGAAATGTATTGGG - Intronic
949160625 3:877538-877560 TCAGAAAAGCAATATGAACAAGG - Intergenic
949184679 3:1176014-1176036 TTTTCAAATCAAAATGTAGAAGG - Intronic
949730603 3:7108199-7108221 TCTGAAATATATAATGTAGAAGG - Intronic
949812273 3:8018603-8018625 TGTGAATAGCAAAATGTCCAGGG + Intergenic
950490082 3:13299305-13299327 TCTAAAAAAAAAAAAGTAGAAGG - Intergenic
952034444 3:29182366-29182388 TCTAAAGAGCAAAATGGTGAAGG - Intergenic
952194637 3:31061952-31061974 TGTCAAAAGCAAAATGGAGTCGG - Intergenic
953071466 3:39524928-39524950 CATGAAAAGCAAATAGTAGATGG + Intronic
953248301 3:41217735-41217757 TCTGATAAGCAAAAAGTAAATGG + Intronic
953451358 3:43009218-43009240 TCAGAAAGGCAACATCTAGAAGG - Intronic
956009603 3:64816631-64816653 TCTGAAAACCAAATGGAAGAGGG + Intergenic
956723389 3:72137648-72137670 CTTGAAAAGCAAACTGCAGAAGG + Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
957106875 3:75900618-75900640 TCTGTAAAGCAAGAAATAGATGG - Intergenic
957193117 3:77036682-77036704 GCTGAATAGATAAATGTAGATGG - Intronic
957307701 3:78479711-78479733 TCTGAAAAGTAAATTATAGCAGG + Intergenic
957498826 3:81026833-81026855 TCAGAAAAGTAAAATATATAAGG - Intergenic
957918492 3:86716938-86716960 TTTGAAAAGGAAAATGTAAAGGG + Intergenic
958797274 3:98719032-98719054 TGAGAAAAGCAAAATGAACATGG - Intergenic
958824422 3:99013252-99013274 TCTGAGTATCAAAATGTATAAGG - Intergenic
959216484 3:103456486-103456508 TATGAAAAGCCAAATGTGAAAGG + Intergenic
959336451 3:105071733-105071755 TCTGAATAGCAAACAGTAGTGGG + Intergenic
959431330 3:106258380-106258402 TGTGAATAGCAAAATGTCCAGGG - Intergenic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960602781 3:119474537-119474559 TTTGAAAAGCCAAATGTGGCCGG + Intronic
961590657 3:127978376-127978398 TCTGAAAAGTAAATGGTAGTGGG + Intronic
961909700 3:130301837-130301859 TTTATAAAGCAAAATGTAAAAGG - Intergenic
962625485 3:137221725-137221747 TCTGAAAAGGGAAAATTAGAAGG + Intergenic
963862494 3:150325388-150325410 GCTCAAAAGCGAAAAGTAGAGGG - Intergenic
965914328 3:173823987-173824009 TCTGGAAAACAAAATGTAAAAGG - Intronic
966197366 3:177326713-177326735 TCTGCAAAGCAGTATGTGGACGG - Intergenic
966523377 3:180896603-180896625 TGTGAATAGCAAAATGTCCAGGG - Intronic
967029691 3:185594302-185594324 TCTGAATGGCAAATTGTAGAAGG + Intronic
967457917 3:189711202-189711224 TCTGAAAAGCAAATTGTAGATGG - Intronic
967487991 3:190056551-190056573 TCTGAAAAGCCAAATCTACAGGG + Intronic
968825324 4:2891878-2891900 TCTGAAAATTAAATTGTAGAAGG + Intronic
969569134 4:7998382-7998404 TCTGAAAAGCAAATTGTCATTGG - Intronic
970456844 4:16232041-16232063 TCTGAAAGGCAAAATTCAAAAGG - Intergenic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
970817038 4:20168806-20168828 AATGAGAAGCAAAATGTAGGGGG - Intergenic
971644230 4:29176672-29176694 TTTAAAAAGAAAAATGTAGCTGG + Intergenic
971653307 4:29307946-29307968 TCTGAAAGGCAAGATTTAGTAGG + Intergenic
971815530 4:31483136-31483158 TCTAAAAAGCAATATTTAGAGGG - Intergenic
972173197 4:36373481-36373503 TTTGATTAGCAAAATGCAGATGG + Intergenic
972451627 4:39206038-39206060 TCTGAAAAGTAAATGGTAGCAGG + Intronic
973015464 4:45132288-45132310 TATTAAAAGCAAAATCTAAAAGG - Intergenic
973220358 4:47719240-47719262 TGGGAAGAGCAAAAGGTAGAAGG - Intronic
973779403 4:54274019-54274041 TTAGACAAGCAAAATGTTGAGGG - Intronic
973814002 4:54601792-54601814 TCTGAAAAAAAAAATGTAAAGGG - Intergenic
974283864 4:59838310-59838332 TCTGAAAAGAAAAAAATAAAAGG - Intergenic
974583711 4:63841025-63841047 TTTAAAAAACAAAATTTAGATGG + Intergenic
974674944 4:65077245-65077267 TGTGAATAGCAAAATGTGCAGGG - Intergenic
975354668 4:73387261-73387283 TCTAATATGCAAAATCTAGAAGG - Intergenic
975579823 4:75896283-75896305 TCTGGAAAGCAAAATGATGTTGG + Exonic
975872747 4:78798750-78798772 TCTCAACAGCAAAAGGAAGAAGG - Intronic
975872954 4:78802149-78802171 TCTCAACAGCAAAACGAAGAAGG - Intronic
976019759 4:80607384-80607406 TCTTAAAAGCAAAAAGTAGAGGG + Intronic
976329305 4:83811068-83811090 TAAGAAAACCAAAATTTAGAGGG + Intergenic
977214483 4:94263387-94263409 CCTGAAAAGCACAAAGTAGGGGG + Intronic
978149576 4:105416809-105416831 TATGAAAAGGAGAATGGAGAAGG - Intronic
978936636 4:114385456-114385478 TCAGGAAAGCAACATGTAGTAGG - Intergenic
979460966 4:120983275-120983297 ACTGTAAAGGAAAATGTAGGGGG - Intergenic
979833957 4:125338199-125338221 TCTGAAATGCAAGATGGACATGG + Intronic
980504866 4:133705452-133705474 TATGAAAACAAAAATGTAGAAGG - Intergenic
980609428 4:135138402-135138424 TCTGAAAGGTAAATTGTAGCAGG + Intergenic
980722713 4:136718760-136718782 TGTGAATAGCAAAATGTCCAGGG - Intergenic
980765170 4:137293312-137293334 TCTGAAAATAAAAATGGAGTTGG + Intergenic
980949875 4:139364576-139364598 TCTGAAAAAAATAATGTAGTAGG + Intronic
981218033 4:142194935-142194957 TCTGAAAAGAAAAATGATGCTGG + Intronic
982034619 4:151333397-151333419 TCTGAAAAAAAAAATGTTAATGG + Intergenic
982346837 4:154369062-154369084 TCAGAAAACTAAAATGTAAAAGG + Intronic
982371733 4:154640872-154640894 TTTGAAAAGCTAAATGTTGAAGG + Intronic
983321401 4:166200615-166200637 TGTGAATAGCAAAATGTCCAGGG - Intergenic
983482123 4:168288173-168288195 TATGAAAATGAAAATGTAAAAGG - Exonic
984275310 4:177602571-177602593 CCTTAAAAGCACAATGTATATGG + Intergenic
984607197 4:181798998-181799020 TCCTTAAAGCAAAATGTAGACGG + Intergenic
985048726 4:185969031-185969053 TTTAAAAAGCAAAATGTATTTGG - Intergenic
985398095 4:189566142-189566164 TCTGAAAAGCAAAAATGACATGG - Intergenic
985914864 5:2909619-2909641 TCTCAAAAGCAACATGGGGACGG + Intergenic
986314747 5:6579136-6579158 CCTGAAGAGAAAAATGTGGATGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986766125 5:10929319-10929341 TCTGGAAAGCAACAAGAAGATGG - Intergenic
986781642 5:11071778-11071800 ACTGAAAAGTAAAATGCTGAGGG + Intronic
988052584 5:26050293-26050315 TCTGAAAAGCAAAAGTTATCAGG - Intergenic
988694860 5:33611090-33611112 CCTCAAAAGCATAATGTTGAGGG + Intronic
988952799 5:36281787-36281809 TCTGAAAAGAAATATTTACATGG - Intronic
989089108 5:37710906-37710928 TCTGAAAAGTAAACAGTAGTAGG - Intronic
990866067 5:60381397-60381419 TCTGAAAAGCAAAAGATATGTGG - Intronic
991014117 5:61913327-61913349 TGTGAATAGCAAAATGTCCAAGG - Intergenic
991353119 5:65739788-65739810 TCTCAAAAGCAACATATAAATGG - Intronic
991860976 5:71012918-71012940 TCTGAAAAGGAAAATAAAGCAGG + Exonic
992097748 5:73378860-73378882 TCTCAAAAGCAAATTGTATGAGG + Intergenic
992464122 5:76987215-76987237 TCAGAATATCTAAATGTAGATGG - Intergenic
993064335 5:83079384-83079406 TCTGAAAACCAAAAAGTAGGGGG - Intronic
993115774 5:83718792-83718814 TCTGAAAAATAAAATGTGCATGG + Intronic
993187992 5:84645269-84645291 TTTTAAAAGCAAAATGTCAAAGG - Intergenic
993574012 5:89579169-89579191 TCTGTAAAGGAGAATTTAGAGGG + Intergenic
993737458 5:91495242-91495264 TCTGAAAAACAGAAAGTAAATGG - Intergenic
993813525 5:92512238-92512260 TCTGAAAAAAAAAATGTAGGAGG + Intergenic
993876739 5:93316323-93316345 TCACAAAGACAAAATGTAGAAGG - Intergenic
994898343 5:105735679-105735701 ACTGAAAAAAAATATGTAGATGG - Intergenic
995354488 5:111223335-111223357 TCTGAAAAGAAAAAAGTTCAAGG + Intergenic
995393730 5:111665870-111665892 TGTGAATAGCAAAATGTCCAGGG + Intronic
995573485 5:113505780-113505802 TAGAAAAAGCAAAATGTATATGG + Intergenic
995830196 5:116346644-116346666 TCTGAATAGCAAAATGTCCAGGG + Intronic
996006942 5:118432799-118432821 TATGAAAAGCAAAATTTTGCCGG + Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996486773 5:124044422-124044444 TCTTTAAAGAAAAATGTATAAGG - Intergenic
997100737 5:130966159-130966181 AGTGAAAAGCAAACTGTAGAGGG + Intergenic
997246114 5:132351008-132351030 CCTGCATAGCCAAATGTAGATGG + Intergenic
999008009 5:148003837-148003859 TGTGAATAGCAAAATGTCCAGGG - Intergenic
999114666 5:149152093-149152115 TCTTAAAAACAAAATGAAGTCGG + Intronic
1000700276 5:164441183-164441205 TCATAAAAGCAAAATAAAGAAGG + Intergenic
1000904880 5:166953027-166953049 GCTGAGAAGCAAAATGTGTAAGG - Intergenic
1001931350 5:175675392-175675414 TCTCAACAGGAAAATGTAGCTGG - Intronic
1003383536 6:5646911-5646933 TAGGAAAAGCAAAATATAGTTGG - Intronic
1003804070 6:9705616-9705638 CCTGGAAAGCAACATGTTGAGGG - Intronic
1004581171 6:16954383-16954405 TCTGAAAAGTAAAAAGTATGTGG - Intergenic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1007005931 6:38362349-38362371 TTTGAAAAGGAAAATGAACAAGG - Intronic
1007033037 6:38646383-38646405 TCTAAAAAGCAGATGGTAGAGGG - Intergenic
1007361189 6:41357408-41357430 TGGGATAAGCAAAAGGTAGATGG + Intergenic
1007950196 6:45865319-45865341 TCTGTAAAACATAATGTAAAAGG - Intergenic
1008113653 6:47521132-47521154 TCTGTAAGGGAAAATCTAGATGG + Intronic
1008319910 6:50098306-50098328 TTTTAAAAGCAAAATGGAGCAGG + Intergenic
1009393894 6:63174820-63174842 TCTCAAAAACATAATGTTGAGGG + Intergenic
1009666931 6:66694511-66694533 TATGAAAAGCATAAAGCAGAAGG - Intergenic
1009908098 6:69893352-69893374 TGTGAATAGCAAAATGTCCAGGG + Intronic
1010291385 6:74141885-74141907 TGTGGAAAGCAAAACTTAGAGGG + Intergenic
1010516283 6:76775357-76775379 TCTGAAAAGTAAAAACTAGCAGG - Intergenic
1010753193 6:79637394-79637416 TTTGAAAATCAAAATGTGGCCGG + Intronic
1011869799 6:91879379-91879401 TCTGAAATTCAAAAGGAAGAAGG + Intergenic
1012071192 6:94618864-94618886 TCTGAAAAGAAAAAAGGAAAGGG - Intergenic
1012212286 6:96535334-96535356 TCTAAAAAGGAAAAAGCAGATGG - Intronic
1012371316 6:98510828-98510850 TCTGAAAAGCATCATAGAGAAGG - Intergenic
1012840875 6:104327491-104327513 ACTGACAAGCAAAAAGGAGATGG - Intergenic
1012949031 6:105497920-105497942 TCTCAAAAGCATAATGTTTAGGG + Intergenic
1013455950 6:110329917-110329939 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1013687181 6:112599199-112599221 TCTGGAAAACAAAATGAAGAGGG + Intergenic
1013850319 6:114505655-114505677 TCTAAGTAGCAAAATGTTGAAGG - Intergenic
1014640147 6:123899412-123899434 TCTAAAAAGAAAAAAATAGAGGG - Intronic
1015029202 6:128573902-128573924 TCTGAAAAGCAGAATGTGTCAGG - Intergenic
1015237486 6:130987740-130987762 TCTGAGAAGAAAAATTTAGGAGG + Intronic
1015813292 6:137182516-137182538 TGTGAATAGCAAAATGTCCATGG + Intergenic
1016312564 6:142749818-142749840 TGTAAAAAGCAAGATGTAGCTGG - Intergenic
1016754411 6:147668137-147668159 TCTGAAAAGGAAAATGAGGTTGG - Intronic
1017076047 6:150619766-150619788 TGTGAAGAACATAATGTAGAAGG - Intronic
1017260654 6:152382978-152383000 ACTCTAAAGCAAAATGTATATGG - Intronic
1017774048 6:157666393-157666415 TCTGAAAAATCAAATGTAGTAGG + Intronic
1018531885 6:164773920-164773942 TCTGGAAAACAAAGTGTACATGG - Intergenic
1019535263 7:1526062-1526084 TCTCAAAAGAAAAAAGAAGAAGG + Intergenic
1020555661 7:9666373-9666395 TGTGAATAGCAAAATGTTCAGGG + Intergenic
1020741736 7:12028501-12028523 TCTTAAAAGTGAAAGGTAGAGGG + Intergenic
1020865448 7:13555609-13555631 TCTTAAAAGAAAAATGTACACGG + Intergenic
1020899278 7:13984270-13984292 TATGAAAAGAAATATGTAAACGG + Intronic
1022059462 7:26777024-26777046 TCAGGAAACCAAAATGTAGCTGG + Intronic
1022108933 7:27216119-27216141 TCTGATAAACAAGATGTAGCTGG + Intergenic
1022999247 7:35790724-35790746 TCTGAAAAGAAAAAAAGAGAAGG - Intergenic
1023169704 7:37378686-37378708 TCTGAAAGGGGAAATGTTGAAGG - Intronic
1023590077 7:41772212-41772234 TGTGGAAAGCAATATGTAGAAGG + Intergenic
1024694422 7:51840070-51840092 TCTGAAGAGCATTATGTTGAAGG + Intergenic
1026555383 7:71404162-71404184 TCTAAAAGGTAAAATGTAAATGG + Intronic
1026675240 7:72423340-72423362 TCAGAAAAGTAAAATGAAAAAGG - Intronic
1027475737 7:78629188-78629210 TCTGAAGTGCAAGATGGAGATGG - Intronic
1028692764 7:93672407-93672429 TTTGAAATGTGAAATGTAGAAGG + Intronic
1028750335 7:94375756-94375778 TCTGAAAAAGAAAAAGTGGAGGG + Intergenic
1028761669 7:94504115-94504137 TGGAAAAAGCAAAATGTAGCAGG + Intergenic
1030222085 7:107107965-107107987 TTTAATAAGCAAAGTGTAGAAGG + Intronic
1030386362 7:108872221-108872243 TTTGAAAAGATAAATGTAGAAGG - Intergenic
1030790725 7:113724843-113724865 ACTAATAAGCAAAATGTACAAGG + Intergenic
1030939205 7:115624477-115624499 AGTGAAAAGTAAAATGGAGATGG - Intergenic
1031324993 7:120384766-120384788 TCTGACAAGCTAAATGTAAATGG - Intronic
1031334604 7:120512594-120512616 TATGAAGAGAAATATGTAGACGG + Intronic
1031644662 7:124209538-124209560 TCTGAAAAGAAAAATATTTAAGG - Intergenic
1032732587 7:134658326-134658348 TCTGGAAAACAAAAAGAAGATGG - Exonic
1033339533 7:140480811-140480833 TGTGAAAAGCACAATGCAAAGGG - Intergenic
1034539635 7:151748643-151748665 ACTGAAAATTAAAATGTAAAGGG + Intronic
1035917850 8:3644494-3644516 TCTGATTAGCAAAAAGAAGATGG + Intronic
1035943053 8:3925903-3925925 TCTGCATAACAAAATGTAGAAGG + Intronic
1036053613 8:5226869-5226891 TTTTAAAAGGAAAATGAAGAAGG - Intergenic
1036541813 8:9721547-9721569 CCAGAAGAGTAAAATGTAGAAGG + Intronic
1037014421 8:13884754-13884776 GCTGAAATTCAAAATGTAAATGG - Intergenic
1037044158 8:14276448-14276470 TCTGCAAAGAAAAATGTAAGTGG + Intronic
1037111281 8:15166736-15166758 TGTGAATAGCAAAATGTGCAGGG - Intronic
1037306650 8:17511810-17511832 TCTGAAAGTTAAAATTTAGAGGG + Intronic
1038613376 8:29072709-29072731 TATGAAAGGTAAAAAGTAGATGG - Intronic
1040714873 8:50238754-50238776 TCTGATATCCAAAATGTACAAGG + Intronic
1040990559 8:53345368-53345390 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1041047012 8:53897050-53897072 TGTGAAAAAAGAAATGTAGAGGG + Intronic
1042077115 8:65008105-65008127 TCTGAAAGTCAAACTGTAAAAGG - Intergenic
1042679030 8:71359588-71359610 TGTGAAAAGTAAACTGTAAATGG + Intronic
1043092302 8:75920960-75920982 TGTGTAAAGCAAATTGTTGATGG + Intergenic
1043606746 8:82009862-82009884 TATCAAGAGAAAAATGTAGAAGG - Intergenic
1044168476 8:89019029-89019051 TCTGATAAACAAAATGGAGTAGG - Intergenic
1044744033 8:95355039-95355061 TCTCAAAGGCAAAATATAGAGGG + Intergenic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1045351419 8:101344156-101344178 TCCGCAAAGCAAGATGTCGAGGG - Intergenic
1045401861 8:101827244-101827266 CCTGAAAAGAAAAAGGCAGAGGG - Intronic
1045427156 8:102078351-102078373 TGTGAAAAATAGAATGTAGAGGG - Intronic
1046114973 8:109774083-109774105 TATTAAAAGCAATGTGTAGAGGG - Intergenic
1046147155 8:110175579-110175601 TCTGAAAAGTAAAAAGTAACAGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046769906 8:118108623-118108645 CCTGAAAAGCAAAAGGTATTGGG + Intronic
1047891772 8:129319938-129319960 TGAGAAAACCAATATGTAGAAGG - Intergenic
1047908971 8:129505507-129505529 TCTGAAAACAAAAATCAAGAAGG + Intergenic
1048057446 8:130881528-130881550 TCTGAAAGGAAAAATGGAAATGG - Intronic
1048279276 8:133093053-133093075 TCTGAATAGCAAACAGCAGAAGG - Intronic
1048803103 8:138212491-138212513 CCTGAAAAGCAAAAGGCAGAGGG - Intronic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1049142551 8:140969105-140969127 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050211273 9:3260130-3260152 TGTGAAAAGTAAAATGTAGGGGG + Intronic
1050224472 9:3436243-3436265 TCTGAAAATGGAAATCTAGAAGG - Intronic
1050324544 9:4487012-4487034 TTGGAAATGCAAAAAGTAGAAGG + Intergenic
1050621363 9:7455521-7455543 TCTGAAAAGCAAAATCTATCGGG - Intergenic
1051060929 9:13044215-13044237 TTTGAAAAGTAAAATGTGGCAGG - Intergenic
1051462777 9:17341717-17341739 TCAGAAAATGAAAATGTAAAGGG + Intronic
1051602444 9:18888846-18888868 TCTGAAAAGCCAAATGGTGAAGG - Intronic
1051735621 9:20196259-20196281 TGTGAAAAGAAATAAGTAGAAGG + Intergenic
1051968709 9:22861990-22862012 TCTGAAAAAAAAAAAGTAGGTGG - Intergenic
1052469284 9:28873492-28873514 TCTGGAACCCAAAATTTAGAAGG + Intergenic
1052495302 9:29216176-29216198 CCATAAAAGCAAAATGTAAAAGG - Intergenic
1052952768 9:34226842-34226864 TCAGAAAAGAAAAATTTTGATGG - Intronic
1053604264 9:39640907-39640929 TCTAAGCAGCAAAATGTTGAAGG - Intergenic
1053726746 9:41010738-41010760 TCTGAATAGAAAAATGGACAAGG + Intergenic
1053862085 9:42396958-42396980 TCTAAGCAGCAAAATGTTGAAGG - Intergenic
1054249276 9:62701507-62701529 TCTAAGCAGCAAAATGTTGAAGG + Intergenic
1054339197 9:63841060-63841082 TCTGAATAGAAAAATGGACAAGG - Intergenic
1054563388 9:66736039-66736061 TCTAAGCAGCAAAATGTTGAAGG + Intergenic
1055181305 9:73390001-73390023 TCAGAAAAACAAGAAGTAGAAGG - Intergenic
1055445015 9:76374089-76374111 TCTGAGAAGCCAAATCCAGATGG - Intergenic
1055789225 9:79903776-79903798 CCTAAAATGCAAAATGTAAAAGG - Intergenic
1055847084 9:80578824-80578846 TCTGCAAAACAAAATGTACTTGG - Intergenic
1056111902 9:83404743-83404765 GCTAAAAAGCTAAATGTTGATGG + Intronic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1056813904 9:89786371-89786393 TCTGAAAAGCAAAGGGTAGCAGG + Intergenic
1057320227 9:94005871-94005893 GCTGAAATGCAAGAGGTAGAAGG + Intergenic
1058003046 9:99886307-99886329 TCTGAAAAGTAAATAGTAAATGG - Intergenic
1058265476 9:102893649-102893671 TTCCAAAAGCAAAATGAAGATGG - Intergenic
1058838458 9:108881017-108881039 TCTTAAAAGCAAAGTGGAGAAGG - Intronic
1059083320 9:111273467-111273489 TCTGAAACCCTAAATGGAGAAGG - Intergenic
1203448568 Un_GL000219v1:86527-86549 TCTGAATAGAAAAATGGACAAGG - Intergenic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186321284 X:8428280-8428302 TCTCTAAAGCTAAAAGTAGAGGG - Intergenic
1187287431 X:17918972-17918994 CTTGAAAAGCAAAATATATAAGG + Intergenic
1187405391 X:18999632-18999654 TCTGAAAAGAAAAATGAATTAGG - Intronic
1188079421 X:25817980-25818002 TGAGAAAAGCAAAAGGAAGAGGG - Intergenic
1188307555 X:28576689-28576711 TCTGAAAAGTAAATAGTAGTAGG - Intergenic
1188365066 X:29305646-29305668 TCTGAAATGCAAAAAGTATGAGG + Intronic
1188535278 X:31190229-31190251 TCTGAAGAGGAGACTGTAGAGGG + Intronic
1188763040 X:34055769-34055791 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1188925810 X:36042310-36042332 TAAGAAAAACAAAATGTATAAGG + Intronic
1188942224 X:36254294-36254316 TCTGTAAATTAAAAAGTAGATGG + Intronic
1189047124 X:37605260-37605282 TTTGAAAAGCAAAAAAAAGATGG + Intronic
1189159321 X:38794588-38794610 TCAAAAAAGCAAGATGTACAAGG - Intergenic
1189833010 X:44994031-44994053 TCTCTAAAACCAAATGTAGATGG - Intronic
1189975474 X:46457600-46457622 TCTGAAAGGCAAACAGTAGAAGG - Intronic
1189983987 X:46537424-46537446 TCTGAAAGGCAAACAGTAGAAGG + Intronic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1192131476 X:68555606-68555628 TCTGAAAAGTAAACAGTAGCAGG - Intergenic
1192594534 X:72392751-72392773 TCTGAAAAGAGATGTGTAGAAGG + Intronic
1193203797 X:78723991-78724013 TCTCAAAAGCAACATTTAGAGGG + Intergenic
1193228879 X:79019334-79019356 TGTGAATAGCAAAATGTCCAGGG - Intergenic
1194066571 X:89268946-89268968 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1194081965 X:89479722-89479744 TCTGAAAAGGAAAACCAAGAAGG + Intergenic
1194146238 X:90268325-90268347 TCTTAAAAGCATAATATTGAGGG + Intergenic
1194888602 X:99349741-99349763 ACTGATAAAAAAAATGTAGATGG - Intergenic
1195382700 X:104285801-104285823 TTTAAAAAGCAAGATGAAGAAGG + Intergenic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1196373980 X:115011327-115011349 TCAGAAAAGCCAACTGTAGGAGG + Intronic
1197062112 X:122193954-122193976 TGTGAATAGCAAAATGTCTAGGG - Intergenic
1197365972 X:125565023-125565045 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1197388024 X:125825129-125825151 TCTGACAAGCAAAATGCTGAGGG - Intergenic
1197560957 X:128021113-128021135 TCTGAACTGCAAAAGGTAGGGGG + Intergenic
1200281951 X:154784611-154784633 TCAGAAAAGAGAAATGCAGATGG + Intronic
1200291823 X:154882821-154882843 TCAGAAAAGAAAAAAGTTGAAGG + Intronic
1200338661 X:155378558-155378580 TCAGAAAAGAAAAAAGTTGAAGG + Intergenic
1200347808 X:155462134-155462156 TCAGAAAAGAAAAAAGTTGAAGG - Intergenic
1200434637 Y:3135911-3135933 TCTGAAAAGGAAAACCAAGAAGG + Intergenic
1200467546 Y:3538532-3538554 TCTTATAAGCAACATGTAGGTGG - Intergenic
1200491980 Y:3837595-3837617 TCTTAAAAGCATAATATTGAGGG + Intergenic
1200720739 Y:6603067-6603089 TGTGAATAGCAAAATGTCCAGGG + Intergenic
1200742998 Y:6875481-6875503 TCTGTATAGCAAGAAGTAGAAGG - Intergenic
1201686833 Y:16714147-16714169 TCTGAAAAGAAAAATAAACATGG - Intergenic