ID: 1179987185

View in Genome Browser
Species Human (GRCh38)
Location 21:44928343-44928365
Sequence ATGGACTCCAGGGGGAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179987185 Original CRISPR ATGGACTCCAGGGGGAAAAC CGG Intronic
900014869 1:141073-141095 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
900045135 1:499682-499704 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
900067332 1:741412-741434 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
900956224 1:5887891-5887913 TGGGACTCCAGGAGGAAGACAGG + Intronic
903852767 1:26318188-26318210 ATGGACTCCAACAGGAAAACTGG + Exonic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
906371857 1:45260710-45260732 ATGGACTTTGGGGGGAAAACTGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909101279 1:71352390-71352412 AGGGACAGCATGGGGAAAACTGG - Intergenic
909764865 1:79342700-79342722 ATGGACTTCAGAGGGAACAGAGG - Intergenic
909881265 1:80881849-80881871 ATGGCCTACTGGGGGAGAACAGG - Intergenic
911321132 1:96415213-96415235 ATGGGCTCTAGGGGGGAAGCAGG + Intergenic
912491826 1:110066685-110066707 CTGGACTCCAGGCAGAAAAGGGG + Intronic
916769916 1:167898078-167898100 GTGGACCACAGTGGGAAAACTGG + Intronic
917728133 1:177847153-177847175 ATGAATTCAAGGGGGAAGACAGG - Intergenic
917798929 1:178552909-178552931 CTGGATTCCAGGGAGAGAACAGG + Intergenic
919827658 1:201515010-201515032 GTGGACTCCAAGGGGCAGACAGG + Intergenic
921425611 1:214997958-214997980 AGAGAGTCCAGGGGGAAAAGGGG - Intergenic
1063079430 10:2751495-2751517 ATGGCTTCCAGGGGGGAATCTGG - Intergenic
1064676583 10:17765924-17765946 TAGGACTCCAGGGAGAAAATGGG - Intronic
1066740344 10:38514007-38514029 ATGGACTCTAATGGAAAAACTGG + Intergenic
1067260468 10:44685335-44685357 CTAGACTCCAGGAGGAAAATTGG - Intergenic
1068219223 10:54022092-54022114 GTGGACTGCAGGTGGAAAAATGG + Intronic
1069143745 10:64862558-64862580 TTGAACTCAAGGGGGAAAAAGGG - Intergenic
1069935569 10:71913422-71913444 CTGGATACCAGAGGGAAAACTGG + Intergenic
1071528386 10:86371663-86371685 TTGGACTCCAGGGGGTCAAGGGG - Intergenic
1071918206 10:90320280-90320302 ATGAATTCCAGGGGGAAAGGGGG - Intergenic
1072135388 10:92540540-92540562 ATCTACTCCAGGGAGAAAAGAGG + Intronic
1072346089 10:94508168-94508190 TTGGAGTCCAGAAGGAAAACAGG - Intronic
1076296184 10:129386574-129386596 CTGGACTCCAGTGGGAAACCAGG + Intergenic
1076689401 10:132213746-132213768 AAGGGCTCCAGGGGAAAAGCAGG + Intronic
1076971464 11:136173-136195 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
1077101220 11:823461-823483 AGGGATTCCAGGGGCAGAACGGG + Intronic
1077924480 11:6667272-6667294 AAGGGCTCTAGTGGGAAAACTGG - Intergenic
1078001776 11:7502515-7502537 ATGGATTCCAGGGAAAAAAGAGG + Intronic
1078672635 11:13378368-13378390 AGGGATTCCAGGGGGAACCCGGG + Exonic
1080214298 11:29823514-29823536 ATGGAGTCATGGGGGAAAAAAGG + Intergenic
1080912067 11:36611420-36611442 ATGTACTCAAGGGTGAGAACAGG + Intronic
1083963573 11:66028385-66028407 GTGGATTCCAGGAGGAAGACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1087274292 11:96145232-96145254 AAGGTCTCCAAAGGGAAAACAGG - Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088205458 11:107387277-107387299 ATGGATTACAGTGGTAAAACTGG - Intronic
1092744648 12:11661913-11661935 ATGGAATCCAGGGGGAATGTTGG + Intronic
1096100756 12:48969432-48969454 GTGAACTCCAGTGGGAAACCAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1100763911 12:97842223-97842245 ATTAACTCCAGGTGGAAAATTGG - Intergenic
1103824585 12:123727259-123727281 TTGGAATCCAAAGGGAAAACAGG - Intronic
1104622947 12:130331918-130331940 ATGGACTCTGGAGGGAAAAGAGG + Intergenic
1106333953 13:28765788-28765810 ATGGACTCAAGTGGGAGAAATGG + Intergenic
1107100302 13:36583143-36583165 ATGGTCTCCAGAGGGCAAAGGGG - Intergenic
1107401526 13:40074202-40074224 AGGGACTCCAGGAGGAAGACTGG - Intergenic
1109241119 13:59889880-59889902 ATGAACTCCCCAGGGAAAACAGG - Intronic
1111831944 13:93340940-93340962 AAGGACTCCAGGGGGAAATTTGG - Intronic
1112977684 13:105341206-105341228 ATGGATTCCTGGGGCAGAACTGG - Intergenic
1114517294 14:23308244-23308266 CTGGTCTCCAGGGGGAAGATGGG + Intronic
1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG + Intronic
1114610300 14:24036003-24036025 GTGGACTCCATGGGGACCACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1118315104 14:64721394-64721416 ATGGACTCCAGGAGAAAGCCTGG - Intronic
1118433901 14:65751661-65751683 ATGGCCTCCAGGGGGTTAAGAGG - Intergenic
1119068883 14:71560435-71560457 ATGTACTCCAGGAGGAAGAAGGG + Intronic
1120725441 14:87934533-87934555 ATTAATTCCAAGGGGAAAACTGG - Exonic
1120760579 14:88281113-88281135 CTGGAGTCCAGAGGGAAAAGGGG - Intronic
1121111131 14:91313881-91313903 AGCGACTCCAGGAGGAGAACGGG - Exonic
1121967419 14:98323554-98323576 ATGGACTCAAGAGGGAATAGTGG - Intergenic
1127379508 15:58418988-58419010 ATGGGCTCCAGGGAGAGAAGAGG + Intronic
1128000611 15:64187874-64187896 ATTGATTCCAGGGAGAAAAAAGG + Intronic
1130780789 15:87038193-87038215 ATGGACTCTAGGCAGAAAACTGG - Intergenic
1131676994 15:94680781-94680803 CTGGAAACCAGGGGGAAAATAGG - Intergenic
1132493155 16:245486-245508 AAGGACCCCAGTGGGGAAACAGG - Intronic
1133997007 16:10756041-10756063 ATGGACTTCAGGGCCAAATCTGG - Intronic
1134611300 16:15610743-15610765 ATTGACTCTAAGGGGAAAAAGGG - Intronic
1140485351 16:75289031-75289053 AAGGTCTCTAGGGGCAAAACGGG - Intergenic
1140896266 16:79327196-79327218 AGGGGCTTTAGGGGGAAAACAGG + Intergenic
1142448787 16:90161349-90161371 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1142458700 17:73940-73962 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
1143275853 17:5710126-5710148 AAGGACACTAGTGGGAAAACTGG - Intergenic
1143655708 17:8292382-8292404 GTAGACTCCAGGGGCAAAATGGG + Intronic
1146495548 17:33318911-33318933 ATGGTCACCAGGAGCAAAACTGG + Intronic
1147635662 17:41962359-41962381 AAGGTCTCCAGGGAGTAAACAGG + Intronic
1148519268 17:48254252-48254274 ATGAACTGAAGGGGGAAAAAAGG - Intronic
1149654716 17:58304225-58304247 CTGGACTACAGTGGGAAAGCTGG + Intronic
1151491672 17:74435357-74435379 ATGGACTCAGGTGGGAAACCTGG - Intronic
1151527402 17:74680477-74680499 ATGAAATCCAGGGGAAAAAATGG + Intronic
1154025770 18:10705851-10705873 ATGGAATGCAGGGGGGAAAATGG - Intronic
1157034141 18:43951296-43951318 ATGGACTCCAGGGAGAAAGGTGG + Intergenic
1158633101 18:59133069-59133091 AGGGACTCCAGCAGGAAAAAAGG + Intergenic
1158741334 18:60145918-60145940 ATGAACGCCAGGGGGATATCTGG - Intergenic
1158971350 18:62669891-62669913 ATCAACTACAGGAGGAAAACTGG - Intergenic
1160648418 19:206453-206475 CTGAACTCCAGGGGGAAGAGGGG + Intergenic
1161827449 19:6577889-6577911 ATGGCCCCCATGGGGAAACCAGG + Intergenic
1161933916 19:7359269-7359291 ATGGACTACAGGGGAGAGACTGG + Intronic
1162305977 19:9874147-9874169 AAGCACTCAAGTGGGAAAACTGG - Intronic
1165789379 19:38482400-38482422 ATGGGCTCCACTGGGAAGACGGG + Intronic
1166283943 19:41811998-41812020 ATCCACTCCAGGGGGTAAAGTGG - Intergenic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166693162 19:44836484-44836506 CTGGACTCCAGTGGGGAAAGTGG + Intergenic
925803634 2:7627123-7627145 ATGGTCTCCACTGGGATAACTGG - Intergenic
926628429 2:15115236-15115258 ATGGCATGCAGGGGCAAAACTGG - Intergenic
928313104 2:30226489-30226511 AGGGACTCCAGGAGGAAAATGGG + Intergenic
929123723 2:38504122-38504144 ATGCATTCCAGGGGGAAAGGAGG + Intergenic
929321621 2:40550709-40550731 ATGGATTCCAGGGAAAAAAAGGG - Intronic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
935800910 2:106694894-106694916 GTTGATTCTAGGGGGAAAACAGG + Intergenic
937294589 2:120802157-120802179 ATGGACTCCTAGGGGAAGTCAGG - Intronic
939301217 2:140341930-140341952 ATGAACTCCAGGGAGAAGAGAGG + Intronic
940279854 2:151978049-151978071 ATGGGCTCCAGGGAGGAAACAGG - Intronic
941840287 2:170075635-170075657 AGGGACACAAGGGGGAATACAGG - Intronic
942320686 2:174733062-174733084 ATGGAACCCAGAGGGAAGACGGG - Intergenic
942767897 2:179478924-179478946 TTGAACTCCAGGGGGAAATTTGG + Intronic
945051889 2:205831879-205831901 ATGGACTCAGAGGGGACAACTGG + Intergenic
945228513 2:207558596-207558618 ATATATTTCAGGGGGAAAACTGG - Intronic
946061130 2:216942436-216942458 GTGGCTTCCAGGAGGAAAACAGG - Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
1168991773 20:2102124-2102146 AGGGGCTCCAGGGGGGAAACGGG + Exonic
1169747280 20:8955265-8955287 ATGAACTCCAGTTAGAAAACCGG + Intronic
1171362389 20:24597061-24597083 ATGGACTCCCAGTGGAAGACAGG - Intronic
1172388449 20:34549890-34549912 ATGGAGTCCTGGGGGAAACAGGG - Exonic
1172918022 20:38458605-38458627 ATGGACATCAATGGGAAAACTGG - Intergenic
1174286785 20:49479743-49479765 ATGGATTGCAGGGGCAAAAGTGG + Intronic
1174530429 20:51208462-51208484 ATGGTCTCCATGGTGAAAAGAGG - Intergenic
1174564108 20:51452389-51452411 ATGGCCTCCAGTGGGAGAAGGGG - Intronic
1175424608 20:58855543-58855565 ATGCCCTCCAGGGAGAAAAGTGG + Intronic
1175503422 20:59466181-59466203 ATGGCCTTCATGGGGAAGACAGG - Intergenic
1176708871 21:10133705-10133727 TTGGGCTCCAGGGGGATATCAGG + Intergenic
1177355033 21:19997000-19997022 ATGGACTCCAGGATCAAGACCGG + Intergenic
1177760115 21:25393679-25393701 CTGGACTCCAGAGGGGAATCTGG + Intergenic
1178576677 21:33798796-33798818 ATGCAGTCCAGGGGAAAGACTGG + Intronic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1182289105 22:29265378-29265400 AAGGCCTCCAGGGGTCAAACAGG - Intronic
949784112 3:7721852-7721874 GTGGACTCAAAGGGGAAAGCAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951038334 3:17960123-17960145 ATCGAATCTAGGGGAAAAACAGG - Intronic
953412011 3:42695969-42695991 TGGGACTGCAGGGGGAAGACAGG - Intronic
953469614 3:43155636-43155658 ATGGTCTCCAGGGCCGAAACAGG + Intergenic
953958094 3:47246869-47246891 ATGGACTGCACTGTGAAAACAGG + Intronic
954429905 3:50465035-50465057 ATGGACTCCAGGAGTACAGCTGG - Intronic
957277924 3:78112856-78112878 ATGGACCCCAGGAGGCAAAGTGG - Intergenic
957626372 3:82657921-82657943 ATGGATTCCAGGGGAAGAATAGG - Intergenic
958658873 3:97040006-97040028 ATTGACTCCAGTAAGAAAACTGG + Intronic
959673532 3:109007498-109007520 ATGGACTCTTGAGGGTAAACTGG + Intronic
961053177 3:123764729-123764751 ATGGACTACAGCGGGGAACCGGG + Intronic
961532907 3:127550738-127550760 ATGGCCTCCAGGGGGAACGTGGG + Intergenic
964770629 3:160221246-160221268 CTGGTCTCCAAGGGGAAACCGGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967690519 3:192468321-192468343 ATGGACATCAGTGGGAAATCTGG - Intronic
967708611 3:192680401-192680423 ACGGACTCCAGCAGGAAAGCAGG + Intronic
968369430 3:198213662-198213684 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
970921053 4:21395534-21395556 ATGGATTAAAGGGGGAAAAAAGG - Intronic
971375543 4:26053034-26053056 ATGTGCTCCAGGGGGAAGATGGG + Intergenic
972540852 4:40037976-40037998 AAGGACATTAGGGGGAAAACTGG + Intergenic
975556417 4:75670180-75670202 AGGGACTCCAGAGGGGAAAGGGG - Intronic
979336941 4:119474244-119474266 TTGGACTCAAGGGGGAAACTGGG - Intergenic
979856809 4:125643472-125643494 AGGGACTTCAGGGAGAAAACTGG - Intergenic
980718027 4:136653652-136653674 ATGGACTACAACGGGAAATCGGG - Intergenic
982035950 4:151345856-151345878 AGGGACTCTAGAGAGAAAACTGG - Intergenic
982990786 4:162271052-162271074 ATGGACTCTAGGCTGAAAAATGG + Intergenic
987251978 5:16109323-16109345 CTGAACTCCAGGGAGAAAAGAGG + Intronic
991669789 5:69036537-69036559 AGGGACTCCAGGGAGATGACAGG + Intergenic
995077766 5:108007200-108007222 ATGGACTCCAGGGCCTAAATTGG - Intronic
996912647 5:128672799-128672821 ATGTGCTCAAGGGGAAAAACTGG + Intronic
1000022970 5:157334834-157334856 AAGGACTTTAGTGGGAAAACTGG + Intronic
1000946003 5:167423867-167423889 ATGGTCTCCAGTGGGAAGAAAGG - Intronic
1001152390 5:169243633-169243655 ATTGACTCCAGGGGAAAAGATGG + Intronic
1002728709 5:181319247-181319269 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1003188752 6:3854780-3854802 ATGGACCCCAGGGGGGGAAGGGG + Intergenic
1003311869 6:4975657-4975679 ATGGACTCCAGGGGGAGTCCAGG - Intergenic
1005431629 6:25763837-25763859 ATGGACTTCTGGGGGAAAAGGGG - Intronic
1006556725 6:34873268-34873290 CAGGACTCCAGGCGGACAACAGG - Exonic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1012254802 6:97019391-97019413 GTGGACTCCACAGGGAACACAGG + Intronic
1013568160 6:111390974-111390996 ATGGACACCAAGTGGAAAAGGGG + Intronic
1014152270 6:118071588-118071610 ATGTGCTCTAGGGGGAAAAAGGG - Intronic
1015103833 6:129512828-129512850 ATGGACTCCAGTGGGAGAAAAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020509901 7:9041328-9041350 ATTGATTTCAGGGGGAAAATGGG + Intergenic
1022418507 7:30198501-30198523 CTGAAGTCCAGGGGGTAAACAGG - Intergenic
1023220589 7:37916994-37917016 AGGGACTTTAGGGGGAAAGCAGG - Intronic
1024951344 7:54863818-54863840 ATAGATTCCATTGGGAAAACTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026698308 7:72616194-72616216 AAGGACTAAAGGGGGAAAAATGG + Intronic
1029883457 7:103841614-103841636 AAGTATTCCTGGGGGAAAACGGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1033277158 7:139980640-139980662 AAGGACTCCAAGGAGAAGACGGG - Intronic
1034020851 7:147640912-147640934 ACGTAGCCCAGGGGGAAAACTGG + Intronic
1034027465 7:147721701-147721723 ATTGAATCCTGGAGGAAAACAGG + Intronic
1034378197 7:150665074-150665096 ATGGGCTCCAGTGGAAAACCAGG + Intergenic
1036915870 8:12803205-12803227 TAGGATTTCAGGGGGAAAACTGG - Intergenic
1037481029 8:19305366-19305388 CTGCACTCCAGTGGGGAAACAGG + Intergenic
1037552974 8:19992942-19992964 ATGGACGGAAGGGGGAAAATGGG - Intergenic
1037897196 8:22665772-22665794 AGGGACTACAGGGTGAAAACAGG + Intronic
1040395609 8:46997398-46997420 ATGCACTCTAGGGCCAAAACTGG + Intergenic
1043823269 8:84894698-84894720 AGGGATTCCAGGTGGAAAGCTGG - Intronic
1045717322 8:105063355-105063377 ATGGACTTCAGAAGGAAAAAAGG - Intronic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048278222 8:133083891-133083913 AGGGGAGCCAGGGGGAAAACTGG - Intronic
1048351623 8:133621178-133621200 AAAGACTCCTGGGGGAAATCAGG - Intergenic
1048965915 8:139614395-139614417 ATGGACCCCAGTGGGAATCCTGG + Intronic
1049285203 8:141771071-141771093 ATTAACTCCAGGAGGGAAACTGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1052508896 9:29389365-29389387 ATGGACACCAGGGTTAAACCAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053144305 9:35702026-35702048 AGGGAGACCAGGGAGAAAACTGG + Intronic
1053199324 9:36142062-36142084 AGGGACCCCAGGGGGATATCAGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057366434 9:94425968-94425990 CTAGACTACAGGTGGAAAACTGG - Intronic
1057656899 9:96962097-96962119 CTAGACTACAGGTGGAAAACTGG + Intronic
1057819691 9:98321534-98321556 CTGGACTACAGGAGGAAAGCAGG - Intronic
1058874007 9:109226229-109226251 ATGGACTGGAGGGTGAATACAGG + Intronic
1062753769 9:138276346-138276368 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1202793632 9_KI270719v1_random:102675-102697 TTGGGCTCCAGGGGGATATCAGG + Intergenic
1203576285 Un_KI270745v1:11125-11147 CTGAACTCCAGGGGGAAGAGGGG - Intergenic
1185544075 X:927361-927383 GTGGACTCCAGAGGGAGAAGTGG - Intergenic
1186154042 X:6707335-6707357 ATGGACTGCAGTGGGGATACAGG + Intergenic
1186357666 X:8803943-8803965 ATGGCCTCCACGGGGCACACCGG + Intergenic
1186400862 X:9258194-9258216 GTGGACTCCAGAGATAAAACAGG - Intergenic
1189461301 X:41245094-41245116 AGGGACTTCACAGGGAAAACTGG + Intergenic
1189492493 X:41481114-41481136 AGAGACTCGAGGGGGAAATCTGG + Intergenic
1192036126 X:67564883-67564905 ATGAAAACCAGGGGGAAAATTGG - Intronic
1193070479 X:77300761-77300783 ATGGACTCCAGGATCAAGACTGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1195962225 X:110397797-110397819 ATGGACTTGGGGGGGCAAACAGG + Intronic
1199184316 X:144897424-144897446 ATGTAATCCTGTGGGAAAACAGG - Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic