ID: 1179987528

View in Genome Browser
Species Human (GRCh38)
Location 21:44929983-44930005
Sequence TTCCCACCAGAAACCCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179987519_1179987528 15 Left 1179987519 21:44929945-44929967 CCTCTGAGGGGACTCAGGCTCCC 0: 1
1: 0
2: 3
3: 42
4: 250
Right 1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 195
1179987522_1179987528 -7 Left 1179987522 21:44929967-44929989 CCACCCTGCTCCCCAGTTCCCAC 0: 1
1: 1
2: 13
3: 126
4: 1226
Right 1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 195
1179987521_1179987528 -6 Left 1179987521 21:44929966-44929988 CCCACCCTGCTCCCCAGTTCCCA 0: 1
1: 0
2: 5
3: 84
4: 805
Right 1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 195
1179987523_1179987528 -10 Left 1179987523 21:44929970-44929992 CCCTGCTCCCCAGTTCCCACCAG 0: 1
1: 0
2: 5
3: 69
4: 614
Right 1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 195
1179987518_1179987528 18 Left 1179987518 21:44929942-44929964 CCTCCTCTGAGGGGACTCAGGCT 0: 1
1: 0
2: 2
3: 23
4: 177
Right 1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 195
1179987520_1179987528 -5 Left 1179987520 21:44929965-44929987 CCCCACCCTGCTCCCCAGTTCCC 0: 1
1: 2
2: 7
3: 145
4: 1427
Right 1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179987528 Original CRISPR TTCCCACCAGAAACCCCAAG TGG Intronic
901946938 1:12711792-12711814 TCCCCACCCGAGACCCCCAGTGG - Intergenic
903021207 1:20396532-20396554 TACCCACCACACACCCTAAGAGG - Intergenic
903608376 1:24591705-24591727 CTCCCACCAGGAACCCCGTGTGG - Intronic
904697469 1:32338276-32338298 TCCCCACCAGACATCCCAGGAGG + Intergenic
906163709 1:43669983-43670005 TCCCCACCAGTTCCCCCAAGTGG - Intronic
908399697 1:63759514-63759536 TTCCCCCCAGAAACCTCAGTGGG + Intergenic
908480296 1:64533041-64533063 TTCCCAACAGAGCCCCAAAGAGG + Intronic
910344246 1:86217466-86217488 TTCCCTCCTGAGTCCCCAAGGGG - Intergenic
911926095 1:103834746-103834768 CTTCCACCAGATACCCTAAGTGG - Intergenic
914230037 1:145757337-145757359 ATCCCAGCAGAAACCCAAGGTGG + Intronic
915920200 1:159970506-159970528 TTTCCAGCAGCAACTCCAAGAGG - Intergenic
915936109 1:160091213-160091235 TTCCCACCACAAACACCATCTGG - Intergenic
918307442 1:183260003-183260025 TTTCTACCACAAACCCAAAGTGG - Intronic
918792771 1:188851500-188851522 TTGGGACCAGAAACCTCAAGTGG + Intergenic
920334684 1:205237107-205237129 TTTCCAGTAGAAACTCCAAGTGG + Intronic
920379121 1:205525752-205525774 TTCCCTCCAGGAGCCCAAAGAGG + Intronic
921704966 1:218312067-218312089 TTCTCCCCTGAAGCCCCAAGAGG + Intronic
922421422 1:225463261-225463283 ATCCCACCAGACACTCCACGCGG - Intergenic
924477785 1:244396360-244396382 TTGCCTCCAGAAATCCAAAGAGG + Intergenic
924504212 1:244666020-244666042 TTGTGACCACAAACCCCAAGAGG + Intronic
924665721 1:246069797-246069819 TGCCCACCACCAACCCCAAATGG - Intronic
924944254 1:248835250-248835272 CTCCCACCACACACCCCCAGTGG - Intergenic
1063723160 10:8605442-8605464 TTACCACCAGAAGCCAGAAGGGG + Intergenic
1066174682 10:32891453-32891475 TTCACTCCATTAACCCCAAGGGG + Intergenic
1067698462 10:48552209-48552231 CTCCAACCAGCACCCCCAAGAGG - Intronic
1068831211 10:61497370-61497392 TTCCCCCAAAAAACCCCAAGTGG + Intergenic
1072332174 10:94364505-94364527 ATCCCACCACAAAGACCAAGAGG + Intergenic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1074922483 10:118030312-118030334 TTCCTATCAGAAACCTCAAGAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1081862219 11:46339661-46339683 TTCCCTCCAAAATGCCCAAGTGG - Intronic
1082181530 11:49126130-49126152 TTTCCAACAGAAATGCCAAGAGG + Intergenic
1082320240 11:50796189-50796211 TTTCCACCATAAACCACAAAGGG + Intergenic
1083817276 11:65141682-65141704 TTCCCACCAGAAACACATAAGGG - Intergenic
1086683965 11:89708715-89708737 TTTCCAACAGAAATGCCAAGAGG - Intergenic
1088779105 11:113116716-113116738 TTCCACGCAGAAACCACAAGAGG - Intronic
1094213754 12:27919474-27919496 ATCCCAGCAGGAACCCAAAGAGG + Intergenic
1095064457 12:37751432-37751454 TTTCCACCATAAACCTCAAATGG - Intergenic
1097168657 12:57099704-57099726 TTCCCAGAAGAAACCCCAGAGGG + Intronic
1099510433 12:83529157-83529179 TTCCCTTCATAAACCCCAACTGG - Intergenic
1101058888 12:100950203-100950225 TTCTGACCAGAAAGCCCTAGAGG - Intronic
1101265673 12:103083838-103083860 TTCCCAGAAGACACACCAAGTGG - Intergenic
1104789683 12:131473665-131473687 TTCCCACTGAAGACCCCAAGGGG + Intergenic
1105666981 13:22570746-22570768 TTCACACCACAAAACCAAAGAGG - Intergenic
1105784329 13:23733600-23733622 ATCCCACCAGAAAGCACATGGGG + Intronic
1105984947 13:25556710-25556732 AACCCACCAGGAACCCTAAGGGG + Intronic
1106220966 13:27745957-27745979 TTCCCAGCTGTAATCCCAAGTGG - Intergenic
1106634570 13:31513864-31513886 TTTCTGCCAGAAGCCCCAAGTGG + Intergenic
1110092210 13:71467161-71467183 TTCCCACAAAAACCCACAAGAGG + Intronic
1111308628 13:86450609-86450631 TGCTCACCAGAAAGACCAAGTGG - Intergenic
1111827570 13:93286916-93286938 TTCCCACATGACACCACAAGTGG + Intronic
1112751002 13:102583288-102583310 TGGCCACCAGTAATCCCAAGAGG + Intergenic
1113217867 13:108063334-108063356 TTCCCAGAAAAAACCCCAACTGG - Intergenic
1115758042 14:36549231-36549253 TCCCCACCTGAGACACCAAGAGG - Intergenic
1116082944 14:40199391-40199413 TTCCCACCAGAACCACAGAGAGG - Intergenic
1118934398 14:70273454-70273476 TTACCAAGAGATACCCCAAGTGG + Intergenic
1119774952 14:77242557-77242579 TGCCCAACAGAGACTCCAAGGGG + Intronic
1120895381 14:89526698-89526720 TTCCCAACAAAAATCCCAACAGG + Intronic
1121157659 14:91701697-91701719 TTCCCACCATTAACTCCATGTGG + Intronic
1123387294 15:19826337-19826359 TTTCCACCATAGACCCCAAAGGG + Intergenic
1126548338 15:49898146-49898168 TCCACTCCAGAAAGCCCAAGTGG - Exonic
1126803721 15:52324072-52324094 TTCCCATCATTAACCCCACGGGG - Intronic
1128462866 15:67884587-67884609 TTCCCTCCAGAACCCCACAGCGG + Intergenic
1131099823 15:89679221-89679243 TCCCCAGCAAAATCCCCAAGAGG + Intronic
1131243254 15:90767134-90767156 TTTCATCCAGAAACCCCAAATGG + Intronic
1132229272 15:100169750-100169772 TTTCCACCTCTAACCCCAAGAGG - Intronic
1133960340 16:10487489-10487511 TTCCCACCGAAGACCCCCAGTGG + Intergenic
1135525423 16:23210224-23210246 TTCCCCTCAGCAACCACAAGGGG + Intronic
1136567968 16:31081254-31081276 GCCCCATCAGAAACCCCCAGAGG + Exonic
1137462945 16:48682284-48682306 TTCACTCCAGTAACCACAAGAGG + Intergenic
1138487045 16:57352600-57352622 TCCCCACCTGCAGCCCCAAGAGG + Intergenic
1138522429 16:57578551-57578573 CCACCACCAGAAATCCCAAGGGG + Intronic
1139447429 16:67006528-67006550 GTCCCACCTGATACCCCAACTGG + Intronic
1141095270 16:81158640-81158662 TACCCACCAGAAGGCCCTAGGGG - Intergenic
1141186163 16:81789007-81789029 TGCCCATCAGAAACACCCAGGGG + Intronic
1141265435 16:82492709-82492731 TTCAGAACAGAAACACCAAGAGG - Intergenic
1141369577 16:83474573-83474595 GTCCCACCAGAAAAAACAAGAGG + Intronic
1141613492 16:85197212-85197234 TTCCCACGTGGATCCCCAAGTGG - Intergenic
1141766384 16:86062504-86062526 TTCCAACCAGCAGCCCCAGGTGG - Intergenic
1142069402 16:88082740-88082762 TGCCCATCAGAAACGGCAAGTGG + Intronic
1142131843 16:88434757-88434779 CTCCCACCAGACTCCCCAGGGGG + Exonic
1147816122 17:43212045-43212067 GTCCCACCACACACCCCTAGAGG - Intronic
1148573945 17:48694819-48694841 TTGCCACCAGAAACTTGAAGAGG - Intergenic
1151179665 17:72317923-72317945 TTCTCAGCTGAAAACCCAAGGGG + Intergenic
1152099829 17:78294549-78294571 ATCCCACCAGCAACCACAATTGG - Intergenic
1153133652 18:1887508-1887530 TTTCTTCCAGAAACCCCAACAGG + Intergenic
1153604644 18:6819649-6819671 CTCCCAGCAAAAATCCCAAGGGG - Intronic
1156108566 18:33695425-33695447 TACCCACCATAAAGCCCAAATGG - Intronic
1157048929 18:44137254-44137276 TTACCACCAGAAACCTCACCAGG + Intergenic
1158485632 18:57863448-57863470 TTCCCATCAAAAACCCAGAGAGG + Intergenic
1161373588 19:3927558-3927580 CCCCCACCAGAAACTCCAGGGGG + Exonic
1162689633 19:12418480-12418502 TTCCCTCCAGAAGATCCAAGAGG - Intronic
1164334135 19:24293349-24293371 TTCTCACCATAGACCCCAAACGG - Intergenic
1165169248 19:33879681-33879703 TTCCCATCCGGAACCCCCAGGGG + Intergenic
1166618514 19:44273193-44273215 TTTCCTCCAGAAATCCCAGGTGG - Exonic
1168284765 19:55325408-55325430 TCCCCACCACCAACCACAAGCGG - Intronic
926143737 2:10384351-10384373 TTCCCTCCAGACATCCCACGGGG - Intronic
928050056 2:27983119-27983141 TTCCCACCAGCACTTCCAAGGGG + Intronic
929947554 2:46382114-46382136 CTTCCACCAGAACCCCCAGGAGG - Intronic
933638142 2:84729489-84729511 TTCTCAACAGAAACTCAAAGAGG + Intronic
936108791 2:109648148-109648170 TTCCCACCCGAGGACCCAAGCGG - Intergenic
936486958 2:112934239-112934261 TTCCCACAAGCAACACCAACAGG - Intergenic
937390320 2:121480383-121480405 TTTCCACCTGAGACCCAAAGAGG - Intronic
937449854 2:121993024-121993046 CTCCCACCTGAAAAACCAAGAGG - Intergenic
937498139 2:122447485-122447507 TTATCAAAAGAAACCCCAAGTGG - Intergenic
938208941 2:129448572-129448594 TTACCTCCAGAAACCCCACCAGG + Intergenic
940248578 2:151647660-151647682 AACCCACCAGAAAACCCAAATGG + Intronic
941017290 2:160371831-160371853 TTCCCGCCAGAAGCCCCACTGGG + Intronic
942462575 2:176178464-176178486 ATCCGACCAGAAATCGCAAGCGG + Intergenic
943705607 2:191030726-191030748 TTTCCACCAGAAACCACCAGAGG - Intronic
947374401 2:229481237-229481259 TTCACACCAGACTCACCAAGAGG + Intronic
947834411 2:233164843-233164865 TTCCCACCAGAAAGGCAGAGAGG - Intronic
948617974 2:239213674-239213696 TTCCCAGGAGAAAAACCAAGGGG + Intronic
1168996854 20:2139645-2139667 TTCACCCCAGCAACCCTAAGAGG - Intronic
1174479298 20:50819619-50819641 GTCACAGCAGAAATCCCAAGAGG + Intronic
1175046665 20:56112909-56112931 TTACCTCCAGAAACCCCACCAGG + Intergenic
1175284037 20:57825583-57825605 TTTCCACCAAAAACCCACAGTGG - Intergenic
1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG + Intronic
1176944529 21:14963020-14963042 TTCGCAACTGAAACCCCATGTGG + Exonic
1177320908 21:19519305-19519327 TTCTGACCAGAAAACACAAGGGG - Intergenic
1177574732 21:22937805-22937827 TACTCACCAGGAACCCCTAGAGG - Intergenic
1178445003 21:32631655-32631677 TTCCCACCCCAGACCCAAAGAGG - Exonic
1178611574 21:34086684-34086706 ATCCTAACAAAAACCCCAAGAGG - Intronic
1179987528 21:44929983-44930005 TTCCCACCAGAAACCCCAAGTGG + Intronic
1180131151 21:45828124-45828146 TTCCCACAAGAGACGCCAACTGG + Intronic
1183331219 22:37222680-37222702 TTCCCAGCAGCCACTCCAAGTGG - Intergenic
1184712279 22:46258951-46258973 TTCCCAGAGGAAACCTCAAGCGG - Exonic
1185025762 22:48410929-48410951 TTCCCTGCAGAAACCCCATTGGG - Intergenic
1185057138 22:48586970-48586992 TTCTCACCAGAGTCCCCATGTGG - Intronic
950006894 3:9697213-9697235 TACCCTCCACAATCCCCAAGAGG + Intronic
950265504 3:11570077-11570099 TGCACATCAGAAACCCCAGGGGG - Intronic
950524679 3:13516914-13516936 TTCCTCACAGCAACCCCAAGAGG - Intergenic
957167917 3:76698794-76698816 TTCCCACCAGAAATACTATGGGG + Intronic
958239080 3:91041193-91041215 TTTCCACCATAAGCCCCAAACGG - Intergenic
958856451 3:99391823-99391845 TTCTCACCAGGAACCTGAAGGGG + Intergenic
961582297 3:127892694-127892716 TCCCCACCCGAGACCCCCAGTGG + Intergenic
961648606 3:128406044-128406066 CTCCCACCAGGACCCCCCAGTGG + Intronic
962355916 3:134694156-134694178 TTACCTCCAGTAACCTCAAGGGG - Intronic
962407620 3:135113505-135113527 CTCCCTCCAGTAACCCCGAGAGG + Intronic
963972562 3:151445773-151445795 TCCCCACCAGAAAACACAACTGG - Exonic
964438519 3:156678121-156678143 TTTCCATCAGAAACCCTCAGTGG + Exonic
968481560 4:835236-835258 GTCCCCCCAGAAGCCCCAGGTGG - Intergenic
969307237 4:6332799-6332821 ACCCCACCAGAAACCCCAGCCGG - Intronic
969892634 4:10273979-10274001 TTCTCCCCAGAAAGGCCAAGTGG - Intergenic
982205601 4:152995311-152995333 TCCTCACCAGAAACCTCCAGAGG - Intergenic
984357963 4:178689631-178689653 TTCCCTCCAGAAACCTCACCAGG + Intergenic
986339880 5:6779837-6779859 TTCCCACTAGAGCCCCCAAAAGG + Intergenic
989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG + Intergenic
991136004 5:63182769-63182791 TTCTCACCACAAACCCTATGTGG - Intergenic
993858037 5:93099684-93099706 TTGGTACCAGAAACCCCAACAGG - Intergenic
995443751 5:112220383-112220405 TTCCCAATACCAACCCCAAGAGG + Intronic
997377339 5:133406474-133406496 TTCCCACCAGCAGCCCTGAGGGG - Intronic
1001483615 5:172104867-172104889 TACCCACTAAAAACCCTAAGGGG + Intronic
1001942434 5:175750305-175750327 TTCCAACCAGAACCTGCAAGGGG + Intergenic
1004345608 6:14846519-14846541 TCACCACCAGAAGCCACAAGAGG + Intergenic
1005003445 6:21265194-21265216 TTCCCCCCAGTAACCCAATGAGG - Intergenic
1005807265 6:29486619-29486641 TTCCAACCACAAACAGCAAGGGG + Intergenic
1005871511 6:29977117-29977139 TTTCCACCAGAACCGCCCAGAGG - Intergenic
1006265738 6:32921736-32921758 TTCACACCAGAAAGACCAAGTGG + Intergenic
1007116018 6:39343803-39343825 TTGCCTCCAGCATCCCCAAGAGG - Exonic
1009271880 6:61624353-61624375 TTCCAACAACAAACACCAAGTGG + Intergenic
1010281009 6:74022567-74022589 TTCTCAAAAGAAACCACAAGTGG - Intergenic
1014320542 6:119923686-119923708 TTCCCACCACATATCCCAAGGGG - Intergenic
1015048825 6:128813942-128813964 ATGCCACCAGAAACCAAAAGAGG - Intergenic
1016526190 6:145004140-145004162 TTCCAACCCTAAATCCCAAGGGG - Intergenic
1017737740 6:157380332-157380354 TTCCCACCCGACAGCCCAGGAGG - Intergenic
1021075935 7:16304682-16304704 TTGCCACCAGAAATCCTAGGAGG - Intronic
1022319570 7:29276225-29276247 TTCCCTTCAGAAACTCCACGTGG - Intronic
1022571827 7:31461171-31461193 GTCCCAGCAGAAACCCAATGTGG + Intergenic
1023396541 7:39757120-39757142 TCCCCACCAAAGACCCCCAGTGG + Intergenic
1023456211 7:40341477-40341499 GGCCCAGCAGAAATCCCAAGAGG - Intronic
1024997209 7:55280804-55280826 TTCCCACCTCAGCCCCCAAGTGG - Intergenic
1027350869 7:77309530-77309552 TTCCCTCCAGAAACACCACTGGG - Intronic
1030305410 7:108013292-108013314 TTCTCCCCAGAAAGCACAAGAGG - Intergenic
1033873689 7:145788261-145788283 TTACCACCTGAAACCCCCTGTGG + Intergenic
1042226467 8:66518790-66518812 TCCCCACCATAAGCCCCAGGGGG + Intergenic
1042719173 8:71808344-71808366 TTCCCTCAAGAAAGCCCTAGAGG - Intergenic
1043516728 8:81001557-81001579 TTCCCTCCAGGGCCCCCAAGAGG + Intronic
1044340550 8:91041358-91041380 TTCCCACAAAAAAACCCTAGAGG - Intergenic
1045993202 8:108334208-108334230 CTGCCACCAGAAGCACCAAGAGG - Intronic
1049337806 8:142095850-142095872 TGCCCCCTAGACACCCCAAGGGG - Intergenic
1050185945 9:2973648-2973670 GTCCTACCAGAAATCCAAAGGGG + Intergenic
1050480316 9:6081185-6081207 TTCCCACCCGAGACCCCCAGTGG + Intergenic
1053519250 9:38761549-38761571 TTACCTCCAGAAACCCCACCAGG - Intergenic
1055072190 9:72178043-72178065 TTCCCAGCAGTAAACCCATGTGG - Intronic
1055963338 9:81841622-81841644 TCACCACCAGAAACTTCAAGAGG + Intergenic
1057004669 9:91546834-91546856 TTCCCTCCAGGAACCCCAGCAGG + Intergenic
1057435167 9:95033330-95033352 TTACCCCCTAAAACCCCAAGTGG + Intronic
1058176621 9:101742692-101742714 TTCCCCCCAAAAATCCCAACAGG - Intergenic
1059696010 9:116731121-116731143 TTCCAACCATAATCCCCAGGTGG - Intronic
1061159368 9:128884324-128884346 ATCCCACCTGAATCTCCAAGAGG - Intronic
1061934038 9:133847427-133847449 TCCCCACCAGCAACCCTAAAGGG + Intronic
1062316627 9:135970528-135970550 TTCCCTCCTGAAACCCCAAAGGG + Intergenic
1062398756 9:136363339-136363361 TCCCTCCCAGAAGCCCCAAGGGG + Intronic
1203778041 EBV:85092-85114 TCCCCATCAGACACCTCAAGTGG + Intergenic
1186477365 X:9868022-9868044 TTCCCACCGAAAACCCCACCCGG + Intronic
1187242546 X:17527044-17527066 TTCCCACCTTCAACCCCCAGAGG - Intronic
1191272159 X:58488116-58488138 TTTCCACCAGAACCCTCAAACGG - Intergenic
1194465956 X:94235905-94235927 TTCTCAGCAGAAACCCCACAAGG - Intergenic
1195179221 X:102340098-102340120 TTCCCACCAGAACTTCGAAGGGG + Intergenic
1195570183 X:106391964-106391986 TTCCCAGCAGAAAGAGCAAGTGG + Intergenic
1197443111 X:126514123-126514145 TTCCCACTATAAATTCCAAGTGG - Intergenic
1199874231 X:151918988-151919010 TTCCCTCCACCAATCCCAAGCGG - Intronic
1199944162 X:152652382-152652404 TGAACACCAGAGACCCCAAGAGG + Intronic