ID: 1179987978

View in Genome Browser
Species Human (GRCh38)
Location 21:44931862-44931884
Sequence TCTCCCTAGCGGAGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179987963_1179987978 15 Left 1179987963 21:44931824-44931846 CCCCGGGCTTCAGGAAAACTGCC 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 155
1179987965_1179987978 13 Left 1179987965 21:44931826-44931848 CCGGGCTTCAGGAAAACTGCCTG 0: 1
1: 0
2: 4
3: 127
4: 2548
Right 1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 155
1179987964_1179987978 14 Left 1179987964 21:44931825-44931847 CCCGGGCTTCAGGAAAACTGCCT 0: 1
1: 0
2: 4
3: 27
4: 267
Right 1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 155
1179987960_1179987978 26 Left 1179987960 21:44931813-44931835 CCTTCTCCTGGCCCCGGGCTTCA 0: 1
1: 0
2: 2
3: 44
4: 400
Right 1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 155
1179987962_1179987978 20 Left 1179987962 21:44931819-44931841 CCTGGCCCCGGGCTTCAGGAAAA 0: 1
1: 0
2: 0
3: 16
4: 215
Right 1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 155
1179987972_1179987978 -6 Left 1179987972 21:44931845-44931867 CCTGGAGGTGGCCGGGGTCTCCC 0: 1
1: 0
2: 1
3: 22
4: 259
Right 1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179987978 Original CRISPR TCTCCCTAGCGGAGGCTGGG CGG Intronic
901749490 1:11397223-11397245 TGTCCCAAGCTCAGGCTGGGAGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903350345 1:22712998-22713020 TCGCCCTGGCAGAGGCTGGTTGG + Intronic
905316397 1:37084229-37084251 GCGCCCTGGGGGAGGCTGGGGGG + Intergenic
914750936 1:150534511-150534533 TCTCCTGAGTGGGGGCTGGGGGG - Intergenic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
916594800 1:166233810-166233832 TCTCCCTAGGGGAGAGTGTGTGG - Intergenic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1067661007 10:48236239-48236261 ATTCCCTAGCTGAGGCTGGGAGG + Intronic
1068130498 10:52889839-52889861 GGTCCATAGCTGAGGCTGGGTGG - Intergenic
1069709243 10:70478567-70478589 TCCTCCTCGCGGAGGGTGGGCGG + Intergenic
1070310912 10:75273214-75273236 CTTCTCCAGCGGAGGCTGGGAGG + Intergenic
1072311155 10:94156686-94156708 CCTCCCTAGAGGATGGTGGGTGG + Intronic
1073317351 10:102592491-102592513 TCTCACTAGCCCAGGCTGGGAGG - Intronic
1077233267 11:1468178-1468200 GCTGCCGAGCGGAGGCTGGGTGG - Intergenic
1077575812 11:3382591-3382613 CCTCCCTAGCAGAGGCCGTGAGG + Intergenic
1081155078 11:39680242-39680264 TTTCCCTACCGGAAGTTGGGTGG + Intergenic
1081710707 11:45213670-45213692 TCGCCCTTGCAGAGTCTGGGTGG + Intronic
1083228020 11:61296692-61296714 TCTCCCTACCTGAAGCTGTGTGG + Intergenic
1083229885 11:61310103-61310125 TCTCCTTAGCTTAGGCTGGTGGG - Intronic
1083482574 11:62959251-62959273 TCTCTCTGGTGGGGGCTGGGAGG + Intronic
1088316170 11:108508885-108508907 TATCCGTAGTGGAGCCTGGGAGG - Exonic
1093908760 12:24722320-24722342 TCTTCCAAGGGGAGGTTGGGTGG + Intergenic
1096156828 12:49345729-49345751 TCTCCCCGGCGGGGGATGGGTGG - Intergenic
1096218097 12:49809439-49809461 TCTCCCTAGAGGACTCTGGGGGG - Intronic
1096776800 12:53969330-53969352 TCTCCACAGAGGAAGCTGGGTGG + Intergenic
1103972967 12:124683543-124683565 GCTGCCTGGCGGAGGCTGGAAGG - Intergenic
1104550303 12:129750661-129750683 ACTCCCTACCAGAGGGTGGGAGG + Intronic
1105705689 13:22966279-22966301 TCTCCCTTGCGTGGCCTGGGAGG - Intergenic
1105858592 13:24391264-24391286 TCTCCCTTGCGTGGCCTGGGAGG - Intergenic
1105937336 13:25114750-25114772 TCCCTCTAGCTGAGGGTGGGCGG - Intergenic
1106956312 13:34942628-34942650 TCTCCCCCGCGGAGGCGGCGGGG - Exonic
1112369405 13:98781891-98781913 TCTCCCTAGAGGTGCATGGGAGG + Intergenic
1117590832 14:57266822-57266844 TCTCCCTAGCGGGGAAGGGGAGG - Intronic
1120055690 14:79921345-79921367 TCTCCCTAGAGAAGTCTGTGTGG - Intergenic
1120789236 14:88563524-88563546 TCCCCCGGGCGGGGGCTGGGAGG - Intronic
1122488641 14:102098056-102098078 TCTCCCTGGAGGTGGCAGGGAGG - Intronic
1124425693 15:29560688-29560710 CCTCCCTAGATGAGGCTGTGGGG - Intronic
1132801669 16:1757747-1757769 TCTCCCTCGCCCACGCTGGGGGG + Intronic
1132910783 16:2309724-2309746 TCTCCCTAGCCGGAGGTGGGAGG - Intronic
1132953233 16:2576812-2576834 TCCCCGCAGCAGAGGCTGGGAGG + Intronic
1132961119 16:2623356-2623378 TCCCCGCAGCAGAGGCTGGGAGG - Intergenic
1133779916 16:8930074-8930096 TCTCCCTAGCCTAGGCAAGGAGG - Intronic
1136534789 16:30893286-30893308 TCTCCCTGTGGGAGGGTGGGGGG + Exonic
1137669382 16:50270640-50270662 CCTCCCTGGGGGAGCCTGGGTGG + Intronic
1138370866 16:56525296-56525318 GCTCCCTAAGGGAAGCTGGGTGG - Intergenic
1139848644 16:69937539-69937561 TCTCCCCAGCTGATGCTGTGCGG + Exonic
1139949753 16:70663186-70663208 TCTCCCTCCAGGAGGCGGGGCGG - Exonic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1141770237 16:86085386-86085408 TCTCCCAAGCGCCGGCTGGTGGG - Intergenic
1142351481 16:89582784-89582806 ACTGCCTGGCGGATGCTGGGAGG - Intronic
1143582249 17:7834259-7834281 TCTCCCAGGCCGGGGCTGGGGGG - Intergenic
1145252202 17:21302805-21302827 TTTCCCTTGGGAAGGCTGGGTGG - Intronic
1147441694 17:40451478-40451500 TCTGCCTAGCCAAAGCTGGGGGG - Intronic
1148021211 17:44555225-44555247 TCTGCCTTGGGGTGGCTGGGAGG + Intergenic
1148123046 17:45223442-45223464 TCTCCCAAGAGAAGGCTGGGGGG + Intronic
1149193813 17:54095452-54095474 TCTTCCTAGCGGAGTGTGAGGGG + Intergenic
1149611691 17:57962219-57962241 GCTCCCTAGAGGAGGTTGTGGGG + Intergenic
1151152613 17:72100825-72100847 TAGCCCTAGAGGAGGCTGGAGGG + Intergenic
1151385623 17:73753596-73753618 GCTACCTAGATGAGGCTGGGTGG + Intergenic
1152157787 17:78646230-78646252 TGTCCCTAGCGAAGGGTGGTGGG + Intergenic
1152292951 17:79451015-79451037 ACTCCCAAGCCCAGGCTGGGGGG + Intronic
1152821274 17:82439094-82439116 TGTCCCAAGCGAGGGCTGGGGGG - Intronic
1153815274 18:8785435-8785457 CCTCCCCAGCGGCGGCAGGGCGG - Intronic
1155537681 18:26833690-26833712 TCTCCCCAGGAGAGGCTGGCTGG + Intergenic
1156877323 18:42030730-42030752 TCTCCCCAGAGGTGGCTGTGTGG + Intronic
1158586005 18:58735657-58735679 TCTCCCTATTTGAGGGTGGGTGG + Intronic
1160055034 18:75471136-75471158 TCTCCATGGTGTAGGCTGGGTGG + Intergenic
1160810975 19:1012802-1012824 TCTCCCTGGCTGGGGCTGGCTGG + Intronic
1161583368 19:5092504-5092526 TCTCCCCAGAGGAGGGTCGGGGG + Intronic
1163509637 19:17727131-17727153 TCTCCACATCGGAGGCTGGGCGG - Exonic
1163673957 19:18646020-18646042 TCTTCCTAGCAGGAGCTGGGGGG - Intronic
1164116365 19:22223090-22223112 TCTCCCAGGCTGTGGCTGGGAGG + Intergenic
1164200059 19:23010558-23010580 TCTCCCAGGCTGTGGCTGGGAGG + Intergenic
1164461470 19:28452669-28452691 TCTGTCTAGTGGAGGCAGGGTGG - Intergenic
1165042731 19:33080777-33080799 TTTCCCTGGAGGTGGCTGGGTGG + Intergenic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
925535117 2:4908612-4908634 GCTCCCTGGAGGAGGCTGGCAGG + Intergenic
927758008 2:25724116-25724138 TCTCCCTTGCCGAAGCTGGACGG - Intergenic
930234740 2:48877717-48877739 TCTCTCTTACTGAGGCTGGGTGG - Intergenic
931459797 2:62440711-62440733 TCTTCATAGGGGAGGCTGGAGGG - Intergenic
933638315 2:84731364-84731386 TCTCCTCAGTGGAGGCTGGGTGG - Intronic
933662645 2:84940238-84940260 TCTCCCTAGCTGAGATTGGGGGG - Intergenic
933760553 2:85669075-85669097 TCTCCCTAGTGGAGGCTCACAGG + Intergenic
934502312 2:94870621-94870643 GCTGCCTGGCGGAGGCTGGATGG - Intergenic
936225758 2:110649112-110649134 ACTCCCTATTGGAGGTTGGGGGG + Intronic
937895373 2:126973647-126973669 TCCCTCTAGGGGAGGCTGTGTGG + Intergenic
938411585 2:131069103-131069125 ACTGCCTAGCAGAGGCAGGGTGG - Intronic
939612887 2:144332055-144332077 TCTTCCTCGCGCAGGCTGAGAGG - Intronic
941040713 2:160619739-160619761 TCTCCCTAGTGGAAGGTGGATGG - Intergenic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
948473770 2:238203547-238203569 GGTCCATGGCGGAGGCTGGGTGG + Exonic
1170813240 20:19691632-19691654 TGGCCCCAGCGGAGGCTGTGGGG + Intronic
1171982693 20:31638640-31638662 GCTCCCCAGAGGAAGCTGGGTGG - Intronic
1172602574 20:36194222-36194244 TCTCGCTGACCGAGGCTGGGCGG - Exonic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1175618485 20:60423513-60423535 TCTCCATAGCTCAGGCTTGGAGG - Intergenic
1176413383 21:6461031-6461053 TCTCCCTGGGGGAGGATGGCAGG - Intergenic
1176549040 21:8213646-8213668 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1176556934 21:8257866-8257888 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1176567972 21:8396684-8396706 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1176575876 21:8440903-8440925 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1176623703 21:9074547-9074569 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1177157348 21:17512980-17513002 CCTGCCGAGCGGGGGCTGGGAGG + Exonic
1179688880 21:43069354-43069376 TCTCCCTGGGGGAGGATGGCAGG - Intronic
1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG + Intronic
1184430656 22:44440009-44440031 TCACCACAGGGGAGGCTGGGCGG + Intergenic
1185176050 22:49327603-49327625 ACTCCCCAGGGGAGGCTGGAGGG + Intergenic
1185253797 22:49820479-49820501 TATTCCCAGCTGAGGCTGGGAGG + Intronic
1203253927 22_KI270733v1_random:129961-129983 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1203261983 22_KI270733v1_random:175040-175062 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
950032686 3:9862847-9862869 GCTTCCCAGCGCAGGCTGGGTGG + Intergenic
950556735 3:13700562-13700584 TCTCCCTAGCGGAGGTTAATGGG - Intergenic
961037611 3:123653453-123653475 ACTCCCCAGCTGAGGCTGGCTGG - Intronic
967469851 3:189848965-189848987 TCTCCTTCCTGGAGGCTGGGGGG - Intronic
968511112 4:996353-996375 TCTCCCTAAAGGAGGCAGGGAGG + Intronic
968808305 4:2788803-2788825 ACTCCCTGGGGGAGGCTGTGTGG - Intergenic
969469889 4:7381551-7381573 TGTCCCTGGCGGAGGGAGGGTGG + Intronic
969591642 4:8125731-8125753 TTTCCATGGCAGAGGCTGGGCGG - Intronic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
986826415 5:11527476-11527498 TCTGCCTAGAGGTGGATGGGTGG - Intronic
986947812 5:13046241-13046263 TCTCCCTTGTGGAGGGTGGAGGG + Intergenic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
1001334421 5:170785589-170785611 ACTCCTTAGAGGAGGCTGAGAGG + Intronic
1002187717 5:177462300-177462322 TCTCCCATGCTGAGGCTTGGAGG - Intronic
1006897977 6:37482889-37482911 TCTGACTAGCGGAGGGTGGACGG - Intergenic
1007722406 6:43892928-43892950 TCTACCACGTGGAGGCTGGGAGG - Intergenic
1013617405 6:111858000-111858022 TCTCCCTGCTGGAGGCTGGCTGG - Intronic
1015872914 6:137795078-137795100 TCTCCCCAGTGGGGGCAGGGAGG - Intergenic
1016104379 6:140144076-140144098 TCTCCCTACTGGAGAATGGGAGG - Intergenic
1018639225 6:165891447-165891469 TCTCCCTGGCTGAACCTGGGAGG - Intronic
1023818302 7:43966395-43966417 TCTGCCCAGAGGAGGGTGGGAGG + Intergenic
1026969034 7:74456798-74456820 TTTCCCCTGAGGAGGCTGGGGGG + Intronic
1029742932 7:102501227-102501249 TCTGCCCAGAGGAGGGTGGGAGG + Exonic
1029760922 7:102600388-102600410 TCTGCCCAGAGGAGGGTGGGAGG + Exonic
1031990307 7:128193044-128193066 TGTCCCTTGCGGTGCCTGGGAGG - Intergenic
1032840020 7:135706049-135706071 TCTCCCTAGAGGAGCCAGGCAGG + Intronic
1035294143 7:157858255-157858277 TCTCCCTACAGGAGTGTGGGTGG - Intronic
1035294389 7:157859104-157859126 TCTCCCTACAGGAGTGTGGGTGG - Intronic
1035294568 7:157859717-157859739 TCTCCCTACAGGAGTGTGGGTGG - Intronic
1036673870 8:10812832-10812854 TGTCCTGAGCGCAGGCTGGGCGG - Intronic
1037654590 8:20872237-20872259 TCTCCCTGCTGGAAGCTGGGTGG - Intergenic
1038493956 8:27988887-27988909 TCAACCCAGAGGAGGCTGGGAGG + Intronic
1039953635 8:42191094-42191116 ACAACCTAGCGGGGGCTGGGGGG - Intronic
1042218296 8:66449191-66449213 TGTCCCTGGCTGTGGCTGGGGGG - Intronic
1045375184 8:101565571-101565593 TCTCCCCAGCAGAGGAAGGGAGG + Intronic
1047050803 8:121110461-121110483 TCTCCCTAGAGGAGCCAAGGGGG - Intergenic
1049688348 8:143948204-143948226 GCTCCCTAGCCAGGGCTGGGTGG + Intronic
1053296205 9:36914688-36914710 TATCCCAAGGGGATGCTGGGTGG + Intronic
1055373534 9:75625079-75625101 TAGCCCCAGCGGAGGCTGGCTGG + Intergenic
1061706689 9:132458333-132458355 TCTCCCTGGCGGGGGAGGGGGGG + Intronic
1062096340 9:134705922-134705944 TCGCCCTAGCTGGGGCTGGCGGG - Intronic
1062116147 9:134810237-134810259 TCTCCCTAGGGGAAGGTGTGGGG - Exonic
1062446094 9:136595595-136595617 TCCCCCGAGGGGAAGCTGGGGGG + Intergenic
1062490055 9:136800569-136800591 TCTCCCTGGCGGGTGCGGGGCGG - Exonic
1203746888 Un_GL000218v1:44975-44997 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1203470327 Un_GL000220v1:113105-113127 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1203478148 Un_GL000220v1:157077-157099 TCTCCCCCGCGGAGGTCGGGGGG - Intergenic
1187759609 X:22566142-22566164 TCTGTCTCGCTGAGGCTGGGTGG - Intergenic
1190115007 X:47620439-47620461 TCTGCCTAGCTGAGCCTGTGTGG - Intergenic
1195255033 X:103082006-103082028 GCACGCTAGAGGAGGCTGGGTGG + Intronic
1196340046 X:114584771-114584793 TGGCCCTAGCGGAGGTTGGGGGG + Intronic
1197941563 X:131795637-131795659 TGTTCCTAGCGGCTGCTGGGAGG - Intergenic
1201160213 Y:11159989-11160011 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1201553523 Y:15244177-15244199 TCTTCCTCGCTAAGGCTGGGTGG - Intergenic