ID: 1179988305

View in Genome Browser
Species Human (GRCh38)
Location 21:44932913-44932935
Sequence CCCGCAGACTGAGCTGCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179988305_1179988317 15 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988317 21:44932951-44932973 CAGCAGCAGAGGACGGGGCCGGG 0: 1
1: 0
2: 4
3: 58
4: 587
1179988305_1179988308 -9 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988308 21:44932927-44932949 GTCTGCGGGGCACGACCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 60
1179988305_1179988321 26 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988321 21:44932962-44932984 GACGGGGCCGGGGCCGGGAGAGG 0: 1
1: 3
2: 17
3: 371
4: 1749
1179988305_1179988319 20 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988319 21:44932956-44932978 GCAGAGGACGGGGCCGGGGCCGG 0: 1
1: 7
2: 16
3: 315
4: 1639
1179988305_1179988322 27 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988322 21:44932963-44932985 ACGGGGCCGGGGCCGGGAGAGGG 0: 1
1: 0
2: 4
3: 83
4: 911
1179988305_1179988320 21 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988320 21:44932957-44932979 CAGAGGACGGGGCCGGGGCCGGG 0: 1
1: 1
2: 18
3: 213
4: 1054
1179988305_1179988314 10 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988314 21:44932946-44932968 GAGGCCAGCAGCAGAGGACGGGG 0: 1
1: 0
2: 5
3: 44
4: 412
1179988305_1179988323 30 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988323 21:44932966-44932988 GGGCCGGGGCCGGGAGAGGGCGG 0: 1
1: 1
2: 26
3: 282
4: 2027
1179988305_1179988313 9 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988313 21:44932945-44932967 AGAGGCCAGCAGCAGAGGACGGG 0: 1
1: 0
2: 3
3: 42
4: 638
1179988305_1179988312 8 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988312 21:44932944-44932966 CAGAGGCCAGCAGCAGAGGACGG 0: 1
1: 1
2: 7
3: 71
4: 807
1179988305_1179988318 16 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988318 21:44932952-44932974 AGCAGCAGAGGACGGGGCCGGGG 0: 1
1: 1
2: 1
3: 50
4: 455
1179988305_1179988309 4 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988309 21:44932940-44932962 GACCCAGAGGCCAGCAGCAGAGG 0: 1
1: 0
2: 10
3: 74
4: 673
1179988305_1179988316 14 Left 1179988305 21:44932913-44932935 CCAAGCGCAGCTCAGTCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1179988316 21:44932950-44932972 CCAGCAGCAGAGGACGGGGCCGG 0: 1
1: 0
2: 2
3: 60
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179988305 Original CRISPR CCCGCAGACTGAGCTGCGCT TGG (reversed) Intronic