ID: 1179990300

View in Genome Browser
Species Human (GRCh38)
Location 21:44944761-44944783
Sequence CCATCTACAGGCCCCAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179990300_1179990304 -6 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990304 21:44944778-44944800 AGATGGCCCGTTAAGATCGTGGG No data
1179990300_1179990303 -7 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990303 21:44944777-44944799 TAGATGGCCCGTTAAGATCGTGG No data
1179990300_1179990306 0 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990306 21:44944784-44944806 CCCGTTAAGATCGTGGGCTCTGG No data
1179990300_1179990309 22 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990309 21:44944806-44944828 GGCCTCTGCCCCTCACCGCCTGG No data
1179990300_1179990308 1 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990308 21:44944785-44944807 CCGTTAAGATCGTGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179990300 Original CRISPR CCATCTACAGGCCCCAGACC CGG (reversed) Intronic