ID: 1179990306 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:44944784-44944806 |
Sequence | CCCGTTAAGATCGTGGGCTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179990300_1179990306 | 0 | Left | 1179990300 | 21:44944761-44944783 | CCGGGTCTGGGGCCTGTAGATGG | No data | ||
Right | 1179990306 | 21:44944784-44944806 | CCCGTTAAGATCGTGGGCTCTGG | No data | ||||
1179990296_1179990306 | 17 | Left | 1179990296 | 21:44944744-44944766 | CCAGGACAGGGCAGGAGCCGGGT | No data | ||
Right | 1179990306 | 21:44944784-44944806 | CCCGTTAAGATCGTGGGCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179990306 | Original CRISPR | CCCGTTAAGATCGTGGGCTC TGG | Intronic | ||