ID: 1179990308

View in Genome Browser
Species Human (GRCh38)
Location 21:44944785-44944807
Sequence CCGTTAAGATCGTGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179990300_1179990308 1 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990308 21:44944785-44944807 CCGTTAAGATCGTGGGCTCTGGG No data
1179990296_1179990308 18 Left 1179990296 21:44944744-44944766 CCAGGACAGGGCAGGAGCCGGGT No data
Right 1179990308 21:44944785-44944807 CCGTTAAGATCGTGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179990308 Original CRISPR CCGTTAAGATCGTGGGCTCT GGG Intronic