ID: 1179990309

View in Genome Browser
Species Human (GRCh38)
Location 21:44944806-44944828
Sequence GGCCTCTGCCCCTCACCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179990300_1179990309 22 Left 1179990300 21:44944761-44944783 CCGGGTCTGGGGCCTGTAGATGG No data
Right 1179990309 21:44944806-44944828 GGCCTCTGCCCCTCACCGCCTGG No data
1179990305_1179990309 -1 Left 1179990305 21:44944784-44944806 CCCGTTAAGATCGTGGGCTCTGG No data
Right 1179990309 21:44944806-44944828 GGCCTCTGCCCCTCACCGCCTGG No data
1179990307_1179990309 -2 Left 1179990307 21:44944785-44944807 CCGTTAAGATCGTGGGCTCTGGG No data
Right 1179990309 21:44944806-44944828 GGCCTCTGCCCCTCACCGCCTGG No data
1179990302_1179990309 10 Left 1179990302 21:44944773-44944795 CCTGTAGATGGCCCGTTAAGATC No data
Right 1179990309 21:44944806-44944828 GGCCTCTGCCCCTCACCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179990309 Original CRISPR GGCCTCTGCCCCTCACCGCC TGG Intronic