ID: 1179991316

View in Genome Browser
Species Human (GRCh38)
Location 21:44949501-44949523
Sequence GCTGCTGCACAGAGGGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179991316_1179991325 23 Left 1179991316 21:44949501-44949523 CCCAGAACCCTCTGTGCAGCAGC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1179991325 21:44949547-44949569 GCCAGGCTCTGAAGCCACAGAGG 0: 1
1: 0
2: 4
3: 55
4: 372
1179991316_1179991321 -1 Left 1179991316 21:44949501-44949523 CCCAGAACCCTCTGTGCAGCAGC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1179991321 21:44949523-44949545 CAGCAGGCCAGAGCGCACCATGG 0: 1
1: 0
2: 1
3: 11
4: 195
1179991316_1179991323 6 Left 1179991316 21:44949501-44949523 CCCAGAACCCTCTGTGCAGCAGC 0: 1
1: 0
2: 0
3: 23
4: 217
Right 1179991323 21:44949530-44949552 CCAGAGCGCACCATGGAGCCAGG 0: 1
1: 0
2: 1
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179991316 Original CRISPR GCTGCTGCACAGAGGGTTCT GGG (reversed) Intronic
900482371 1:2905411-2905433 GCTGGAGCACAGAGGGTCCCCGG - Intergenic
900848963 1:5126920-5126942 TCTGCTGCACAGCGGGCTCGGGG + Intergenic
901427720 1:9193228-9193250 GGTGCTATACAGAGGCTTCTTGG + Intergenic
901460572 1:9388859-9388881 GCTGAGGCCCAGAGGGTTCAAGG + Intergenic
903744037 1:25574679-25574701 GCTGATGCAGCGAGTGTTCTGGG + Intergenic
903853191 1:26320562-26320584 GCTGCTGCACAGCTGGCTCTTGG - Intergenic
904631043 1:31842556-31842578 GCTGCTGCACAGAGGTGGCTCGG - Intergenic
904825898 1:33273523-33273545 GCTGCTTCTCAGACAGTTCTGGG - Intronic
904965884 1:34372238-34372260 GCAGCTGCATACAGGGGTCTGGG + Intergenic
905498865 1:38419870-38419892 TCTGCTCCACAGTGGGTACTTGG + Intergenic
905988200 1:42307412-42307434 GCTGCTGCCCATAGGGCTCAGGG - Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
907371893 1:54009170-54009192 CCTGGTGCACAGAGCGTTCCAGG - Intronic
908512392 1:64859910-64859932 GCTGCTGCAAAGAGGATGGTAGG + Intronic
908855402 1:68421171-68421193 GCTGATTCACAGAGAATTCTAGG - Intergenic
910195671 1:84637332-84637354 GCTTCTGCACAGAGAGTTGTTGG + Intergenic
913998228 1:143669083-143669105 TCTGCTGGACAGAGGAGTCTGGG - Intergenic
915125189 1:153658839-153658861 GCTGCTGCACAGCGGGTCGCAGG - Exonic
915734867 1:158078351-158078373 GCTGCGGCAGAGAGGATGCTGGG - Intronic
918557591 1:185822069-185822091 GGTGGAGCACAGAGGATTCTTGG + Intronic
918868056 1:189929576-189929598 TCTGCTGCAGAGAGGGGTCCCGG + Intergenic
919918473 1:202153736-202153758 GCTGCCGCACAGTGTATTCTGGG + Exonic
920453687 1:206080778-206080800 GCTCCTGCTCAGAGGCTACTGGG - Intronic
921172820 1:212564387-212564409 GGTGGAGCACAGAGGGTTTTTGG + Intergenic
922210216 1:223480669-223480691 CCTGCTGCACAGAGCGCCCTTGG + Intergenic
922806326 1:228391771-228391793 GGTGCTGCACAGGTGGTGCTGGG + Intergenic
1063044121 10:2374008-2374030 GCTGCTGCACAGACGGCCTTGGG + Intergenic
1067054777 10:43044194-43044216 GCAGCTGCACAGAGGCTGGTGGG + Intergenic
1068306269 10:55212363-55212385 GATGCTGCAGAGAGGGGTCCTGG - Intronic
1069605142 10:69734034-69734056 TCTGCTTCTCAGGGGGTTCTAGG - Intergenic
1069766149 10:70861790-70861812 GCAGCTGCGGAGGGGGTTCTAGG + Intronic
1070920701 10:80183808-80183830 GCTGATGCACTGAGGGTTTCTGG - Intronic
1071425169 10:85542282-85542304 GCTGCTGCACAGGTGCTCCTGGG + Intergenic
1071461276 10:85899092-85899114 GCTGTTGTACATAGGGTTCATGG + Intronic
1072555034 10:96508316-96508338 GCTGCCCCAGAGAGGGCTCTTGG + Intronic
1075309884 10:121405217-121405239 ACTCCTGAACAGAGGGTTCCAGG + Intergenic
1075311668 10:121419578-121419600 GCTGCTCTACAGAGGGGTCAAGG + Intergenic
1076351196 10:129816200-129816222 CCTGGTGCACAGAGGCCTCTCGG - Intergenic
1076762777 10:132613712-132613734 GCGGCTGCACTGAGGGGCCTCGG + Intronic
1077075397 11:698936-698958 GCTGCTGCACAGAGAGCACTCGG + Intronic
1077090270 11:775233-775255 GCTGCTCCTCAGCGTGTTCTGGG - Intronic
1077331936 11:1987669-1987691 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1077433305 11:2526588-2526610 CCTGCTGCACGGAGGTTTCTGGG - Intronic
1081695174 11:45104697-45104719 TCTGCAGCACTGAGGTTTCTGGG - Intronic
1083731617 11:64655403-64655425 GCGGCTGCACAGAGGGGACAGGG + Intronic
1083921858 11:65785659-65785681 GCTGGTACACAGTGGGTGCTCGG - Intergenic
1084396834 11:68916647-68916669 GCGGCAGCAGAGAGGGTGCTGGG + Intronic
1084652956 11:70499761-70499783 GCTGCTGCAGAGAGGCCGCTGGG + Intronic
1085276176 11:75301721-75301743 GCGGCTGCAGAGAGGTTCCTAGG + Intronic
1088502114 11:110492991-110493013 TCTGCTACAGAGAGGGGTCTTGG + Intergenic
1088773825 11:113062620-113062642 GCTACTTCACAGAGGGGTCAGGG + Intronic
1089591613 11:119545871-119545893 GCTGCTGCAGGGAGGGTGCTGGG + Intergenic
1090379946 11:126319421-126319443 GCTGCGGGACAGCAGGTTCTGGG - Intronic
1091122271 11:133066090-133066112 GCTGCTGGCCTGAGGGTCCTGGG - Intronic
1202814917 11_KI270721v1_random:42845-42867 CCTGCTGCTCAGAGGTTCCTAGG + Intergenic
1096204041 12:49706895-49706917 GCGGCTGCTCAGAGGTTCCTGGG + Intronic
1096240520 12:49957466-49957488 CCTGGTGCACAGTGGGTGCTTGG - Exonic
1097185855 12:57195977-57195999 GCTGGTGCAGTGTGGGTTCTTGG - Exonic
1098312537 12:69162019-69162041 GTGGCTGCACACAGGGTTGTGGG + Intergenic
1098465892 12:70784580-70784602 GCCGCTGCAGGGAGGGTACTGGG - Intronic
1100790654 12:98126461-98126483 GCTGGAGCAGAGTGGGTTCTTGG - Intergenic
1102748102 12:115267795-115267817 TCTGCTGCACAGATGGTTGGGGG + Intergenic
1102980680 12:117238472-117238494 TCTGCTGCACAGAGGGGTCCTGG - Intronic
1103828937 12:123763202-123763224 CCGCCTCCACAGAGGGTTCTGGG - Intronic
1104484580 12:129139405-129139427 GCTGCTGAACAGAGGGTTTGTGG - Intronic
1104575784 12:129964858-129964880 TCTGCTGCAGAGAGGGGTCCTGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107295417 13:38902181-38902203 GCTGCTGTCTAGAGGGTGCTGGG + Intergenic
1110202938 13:72874597-72874619 GCAGCAGCACAGAGAGTTTTTGG + Intronic
1111012700 13:82331588-82331610 TCTGCTGCAAAGAGGGGTCCCGG - Intergenic
1111702945 13:91713616-91713638 GCTGGTGCTCAGAGATTTCTTGG - Intronic
1111964031 13:94842393-94842415 GCTTCTACACAGAGGCTCCTTGG + Intergenic
1113613752 13:111666126-111666148 GCTGCTGCCTACAGTGTTCTGGG + Intronic
1113683319 13:112260415-112260437 GCTGGTGCACAGGGTGGTCTGGG + Intergenic
1114527902 14:23377879-23377901 GATGCTGCCCAGTGGTTTCTGGG - Intronic
1119265016 14:73259381-73259403 GCTGCTGCAGAGAGGGAGCGGGG - Exonic
1119650342 14:76378610-76378632 GCTGCTGCCCAGTGGGTCCTGGG - Intronic
1121711820 14:96044095-96044117 GCTGATCCACAGAGGGTCCCTGG - Intronic
1122035473 14:98946191-98946213 GCTGCTGTACAGAGGGATGTTGG - Intergenic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1123138918 14:106056134-106056156 CCTGCTACACAGAGAGCTCTGGG + Intergenic
1123631161 15:22260447-22260469 TGTGCTGCGCAGAGGGTCCTAGG + Intergenic
1126806806 15:52358635-52358657 GCTGCTGAACAGAGGCTACATGG + Intronic
1127516122 15:59694952-59694974 GCAGATTCACAGAGGCTTCTAGG + Intergenic
1130301315 15:82681313-82681335 GCTGCTTCTCAGAGGGTTTGAGG - Intronic
1130308371 15:82730836-82730858 TCTGCTGCAGAGAGGGGTCCTGG + Intergenic
1131616007 15:94018040-94018062 GCTGGAGGAGAGAGGGTTCTGGG + Intergenic
1132543752 16:523626-523648 GCACCTGCACTGAGGGTTCAAGG - Intergenic
1133332177 16:4981638-4981660 GCTGCTGAGCAAACGGTTCTTGG + Intronic
1136025423 16:27465313-27465335 GGAGCTGCGCAGACGGTTCTCGG - Exonic
1136271749 16:29152679-29152701 GCTGCCGCACTGAGAATTCTTGG + Intergenic
1138656837 16:58496268-58496290 GCTGCAGCTCAGAGGGCTCAGGG - Intronic
1139433263 16:66922487-66922509 GCTCCTGTACTGAGGGTACTGGG + Intronic
1141895146 16:86954372-86954394 GCTGCAGCCTGGAGGGTTCTGGG - Intergenic
1142075416 16:88114839-88114861 GCTGCCGCACTGAGAATTCTTGG + Intronic
1142278986 16:89137958-89137980 GCTGAGACCCAGAGGGTTCTGGG - Intronic
1142923572 17:3212823-3212845 TCTGCTGGAGAGAGGGTTCTTGG + Intergenic
1143057304 17:4171885-4171907 ACAGCTGCGCAGAGGGCTCTGGG + Intronic
1150070279 17:62144369-62144391 TCTGCTGCAAAGAGGGGACTTGG - Intergenic
1150483733 17:65530305-65530327 GCTGCTGCTCAGTGGGTGCCTGG - Intronic
1151357620 17:73569935-73569957 CCTGCTGCAGAGAGGCTCCTCGG - Intronic
1152371857 17:79893196-79893218 GCTGATGCATGGAGGGTGCTTGG + Intergenic
1157514638 18:48302152-48302174 GCTTCTGCACAGGGGATTATAGG - Intronic
1157574968 18:48737427-48737449 GCTGCTGCACATGGAATTCTAGG + Intronic
1158031524 18:52971205-52971227 GCTCCTGCACAGGGAATTCTGGG - Intronic
1160435682 18:78850659-78850681 TTTGCTGCACAGAGGCTTTTGGG + Intergenic
1161831057 19:6604840-6604862 TCTGCTGCAGAGAGGGGTCCCGG + Intergenic
1162262049 19:9541539-9541561 GCAGCTGCACAGGGTGTACTGGG - Intergenic
1162968286 19:14165973-14165995 GCTGCTGCTGAGGGGCTTCTAGG - Intronic
1163691232 19:18739557-18739579 GCTGCTGAGCAGCGGGTCCTGGG + Intronic
1164425452 19:28137594-28137616 GCCGCTGCACAGAGCCTTCATGG - Intergenic
1164535655 19:29084874-29084896 GATGCTGCACTGAGGGTCCCCGG + Intergenic
1165046635 19:33109828-33109850 TCTGCTGCTCTGAGCGTTCTGGG - Exonic
1165692155 19:37871996-37872018 TCTGCTGCAGAGAGGGGTCCTGG + Intergenic
1166295145 19:41885261-41885283 GCTGCTCCACAGAGGCTTGGGGG - Intronic
1166749971 19:45159919-45159941 GCTGCTACACAGATGCCTCTGGG + Intronic
1168375936 19:55879320-55879342 TCTGCTACAGAGAGGGGTCTCGG + Intronic
924997503 2:375847-375869 CCTTCAGCACAGAGGGTCCTTGG - Intergenic
925538392 2:4940466-4940488 CCTGCTGCACAGAGAGTTTGTGG - Intergenic
926747203 2:16168657-16168679 GCTGCTTTGAAGAGGGTTCTTGG - Intergenic
926797051 2:16627791-16627813 GCTGCTACCCAGAGGGCACTAGG - Intronic
927483733 2:23474321-23474343 GCTGGTGAACAGAGAGGTCTAGG - Intronic
927504138 2:23602365-23602387 GCTCCTGCACAGAGGCCTCCTGG + Intronic
928198282 2:29230385-29230407 GCTGCAGCAGAAAGGGTTTTAGG - Intronic
932460584 2:71879528-71879550 GCAGCTGCAGAGATGGCTCTGGG + Intergenic
932770706 2:74499438-74499460 GCTGCGGCGCAGAGGGTGCTCGG + Exonic
935008621 2:99108264-99108286 GCTACTATACACAGGGTTCTAGG - Intronic
935179894 2:100679859-100679881 GCATCTGCTCAGAGGGTTCAGGG + Intergenic
935707885 2:105872204-105872226 GTAGCTGCAGAGAGGGATCTGGG - Intronic
935789735 2:106580241-106580263 GCTGCTGCTCAGAGGCTTTCGGG + Intergenic
936045999 2:109188389-109188411 GCTGCTGCTCAGCGGGGTCTGGG + Intronic
936056794 2:109267846-109267868 CCTGCTGGACAGAGGTTGCTTGG + Intronic
936056944 2:109268494-109268516 CCTGCTGGACAGAGGTTGCTTGG - Intronic
936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG + Intergenic
937223559 2:120355604-120355626 GCTGCTGCACCCAGGGTTGGGGG + Intergenic
937249254 2:120512802-120512824 GCTGCTGAACAGAGGTGACTGGG - Intergenic
939407119 2:141772767-141772789 GCTGCTTCACACTGGGTTCCTGG + Intronic
945872823 2:215245941-215245963 GCTGCTGCAGAGGGTGTGCTGGG - Intergenic
948950137 2:241244562-241244584 TCTGCTGCATAAAGGTTTCTAGG - Intronic
1169799446 20:9499938-9499960 GCAGCAGCACAGTGAGTTCTAGG + Intergenic
1170327781 20:15176019-15176041 TCTGCAGCAGAGAGGGTACTGGG - Intronic
1170910822 20:20566120-20566142 GCAGCAGCACAGGGGGATCTGGG - Intronic
1172022387 20:31923923-31923945 GCTGCTGGACATAAGGATCTGGG - Intronic
1173643708 20:44620746-44620768 GCTGCTGCACACACCTTTCTGGG + Intronic
1173926534 20:46785231-46785253 GTTGCAGCAAAGAGGGTGCTGGG - Intergenic
1175163559 20:57027095-57027117 GCTGTTACACAGAATGTTCTGGG - Intergenic
1175456656 20:59120474-59120496 GCTGCTGATCAGAGGGTCCAAGG + Intergenic
1179727740 21:43349686-43349708 GCTGCTCCACAGAGCGCCCTGGG - Intergenic
1179991316 21:44949501-44949523 GCTGCTGCACAGAGGGTTCTGGG - Intronic
1180025444 21:45158583-45158605 GCTGCTGCACAGTGGCCTCGGGG - Intronic
1181003445 22:19998583-19998605 GCTCCTGCAGAGAGGCTTCTCGG - Intronic
1181111011 22:20602983-20603005 GCCTCTTCAGAGAGGGTTCTGGG - Intergenic
1181115721 22:20631642-20631664 GCAGGTGCAGAGAGGGCTCTGGG + Intergenic
1181591827 22:23889988-23890010 GCTGAGGCACAGAGTGATCTGGG - Intronic
1181685880 22:24527744-24527766 CCTGCAGCACAGAGAGTTCAAGG - Intronic
1181838138 22:25627982-25628004 GCTTTTGCATAGAAGGTTCTAGG - Intronic
1183642187 22:39099521-39099543 GCAGCTGGAAAGAGGGATCTGGG + Intronic
1184403656 22:44287839-44287861 GCTGCAGCAGGGAGGGTGCTGGG - Intronic
1184950934 22:47842209-47842231 GCTGCAGCAGACATGGTTCTTGG + Intergenic
1185246297 22:49775051-49775073 TGTCCTGCACAGAGGGATCTTGG + Intronic
949949347 3:9216417-9216439 GCTGCTCCACAGGGTGTTTTGGG - Intronic
950543023 3:13623354-13623376 GCAGCTGCAAAGTGGGTTCTGGG + Intronic
950710221 3:14808759-14808781 GCTCCTGCCCTGGGGGTTCTAGG + Intergenic
952386089 3:32842777-32842799 ATTGCAGAACAGAGGGTTCTTGG - Intronic
952871880 3:37908050-37908072 GCTGCTACACTGAGGGTTATGGG - Intronic
954497845 3:50982602-50982624 GCTGCTGCAGAGAGGGTACAGGG + Intronic
954625765 3:52021155-52021177 GCTTCTGCCCTAAGGGTTCTGGG + Intergenic
954907167 3:54072698-54072720 GCTTCTACACAGAGGCTTCAGGG + Intergenic
955076695 3:55620656-55620678 ACAGCTGCACAGAGGGAACTGGG + Intronic
955084919 3:55693448-55693470 TCTGGGTCACAGAGGGTTCTTGG - Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
956863416 3:73346825-73346847 GCTGGGGTACAGAGGGTTATGGG + Intergenic
968579025 4:1381146-1381168 GATGCTGCCCTGAGGGTCCTGGG + Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
968943677 4:3652525-3652547 GCTGCTGCGCCCAGGGTTCTTGG + Intergenic
969032995 4:4228171-4228193 GCTGCTGCACGGTGGGATGTGGG - Intergenic
969901654 4:10355689-10355711 GATGCTGCCCAGGGGGTCCTTGG - Intergenic
974937931 4:68430596-68430618 GCTGCTTCTCAGAGGGATGTTGG - Intergenic
974939370 4:68446331-68446353 GCCTCAGCACAGAGGTTTCTTGG + Intergenic
975770183 4:77711937-77711959 TCAGCTCCACAGAGGGTCCTTGG + Intergenic
978687452 4:111463123-111463145 GCTGTTGCATAGAGTGATCTGGG + Intergenic
979195261 4:117913820-117913842 GCTGCTGGACACAAAGTTCTTGG + Intergenic
980875671 4:138659594-138659616 GCTGCTGCCCCCAGGGCTCTGGG + Intergenic
981419673 4:144534720-144534742 TCTGCTGCACAGAAGGGTCATGG - Intergenic
982691165 4:158549607-158549629 GGTGATGTACAGAGGGTTTTTGG + Intronic
984687922 4:182692263-182692285 TCTGCTGAACAGATGGTTATAGG + Intronic
986777422 5:11030007-11030029 TCTGCTGGACATAGGATTCTTGG + Intronic
991247911 5:64527172-64527194 GCTAATGCTGAGAGGGTTCTAGG + Intronic
992138667 5:73773222-73773244 GCCCCTGCACAGAGGGCCCTTGG - Intronic
993069009 5:83134835-83134857 CCTTCTGCCCAGAGGGTTCATGG - Intronic
993656493 5:90584527-90584549 TCTGCTGTATACAGGGTTCTTGG + Intronic
995062043 5:107821709-107821731 TCTCATGCACAGAGGGTGCTTGG + Intergenic
995516601 5:112960433-112960455 GCCCCTGCACAGATGGATCTAGG - Intergenic
997443480 5:133925274-133925296 GCTGGTGCTCAGAGGGTGATGGG - Intergenic
999281636 5:150370002-150370024 GCGGCTGCTGAGAGGGTTCTGGG + Intronic
999691260 5:154147833-154147855 TATGATGCACAGAGGGTTCCAGG - Intronic
1001425052 5:171617472-171617494 GCAGCTGCTCAGAGGCATCTGGG + Intergenic
1003294092 6:4808497-4808519 GCTGCTTCTCAGAGGGATTTGGG - Intronic
1005850658 6:29818252-29818274 CCTGCTGCCCAGATGGGTCTGGG - Intergenic
1006919346 6:37617165-37617187 GCTGCTCCAGAGAGAGGTCTTGG - Intergenic
1007727346 6:43924423-43924445 GCGGCTGCACTGCGGGCTCTGGG - Intergenic
1018007991 6:159641198-159641220 TCTGCTACAGAGAGGGGTCTGGG - Intergenic
1020945362 7:14599320-14599342 GCTAGTTCACAGAGGGTTTTAGG - Intronic
1022518467 7:30990172-30990194 GCAGCTGGACAAAGGGTTCTGGG - Intronic
1023912522 7:44566047-44566069 GAAGCTGCGCAGTGGGTTCTGGG + Exonic
1024690552 7:51796908-51796930 TCTGCTGCAGAGAGGGGTCCTGG - Intergenic
1026412006 7:70132953-70132975 GCTGCTGCATGGAGGGCTGTGGG + Intronic
1026916119 7:74121223-74121245 GCAGCTGGACAGAGGTTTCTGGG + Exonic
1028727180 7:94101041-94101063 GCAGCTGCAGAGGGGGTGCTGGG + Intergenic
1029156685 7:98522226-98522248 CCAGCTGCACAGAGGGCACTAGG - Intergenic
1030258525 7:107538425-107538447 TCTGCTGCAGAGAGGGGTCCTGG - Intronic
1031504125 7:122559818-122559840 GGTGGTGCCCAGAGGGTTCTCGG - Intronic
1031861101 7:126981273-126981295 GTTGCTTCAGACAGGGTTCTTGG - Intronic
1033283022 7:140019033-140019055 GCAGCTGAACAGTGGGTTCCGGG - Intronic
1036173190 8:6510198-6510220 TCTGCTGCAAAGAAGCTTCTTGG + Intronic
1037924145 8:22831625-22831647 GTTACAGCACAGAGGGTCCTTGG - Intronic
1039916996 8:41867458-41867480 GCTTCTGCACAGAAGGGTCCTGG + Intronic
1040003695 8:42600278-42600300 GCAGCTGCAGAGGGGGTGCTAGG - Intergenic
1041898865 8:62958522-62958544 GCTGCTGACCACTGGGTTCTGGG - Intronic
1043454277 8:80398410-80398432 GCTTCTGCACTGAGGGTCCATGG + Intergenic
1044797388 8:95917784-95917806 GCTCCTCCACAGAGGATTCCTGG - Intergenic
1046268302 8:111859663-111859685 GCTGCTGCCCGGAGGGTTGGGGG + Intergenic
1046669032 8:117037205-117037227 GCTGCTGCACAAAATGTTTTAGG + Intronic
1047195981 8:122721819-122721841 CCTGCTGCACAGAGACTTCAGGG - Intergenic
1049181315 8:141224109-141224131 TCTGCTGCACACAGAATTCTGGG + Intronic
1049185163 8:141246706-141246728 GCTGTTACACAGAGGGGTCAGGG - Intronic
1049520196 8:143084010-143084032 ACAGCTACACAGAGGCTTCTTGG - Intergenic
1050162442 9:2732607-2732629 GCTGCTGCAGTGAGGGTGTTAGG - Intronic
1052935785 9:34091957-34091979 TCTGCTTCCCACAGGGTTCTTGG + Intronic
1057518774 9:95743888-95743910 GCTTTTGCCCAGAGGGTGCTAGG - Intergenic
1059389399 9:113989288-113989310 GCTGCTGCACTGACGGTTGCTGG + Intronic
1061549276 9:131323966-131323988 GATGCTGCACAGAAGGTCCCTGG + Intergenic
1185470503 X:378930-378952 GCTCCTGCCCTGAGGGTTCTAGG + Intronic
1188275242 X:28192392-28192414 TCTGGTGCACAGAGGGGTCCTGG - Intergenic
1198618110 X:138480374-138480396 GATGCTGCAGACAGGGTTCCCGG + Intergenic
1198749701 X:139926510-139926532 CCTGCTGAGCAGTGGGTTCTAGG - Intronic
1199641632 X:149868011-149868033 ACTGCTGCACAAAGTGCTCTGGG - Intergenic
1200955323 Y:8938481-8938503 GCAGCTGCAGAGGGGGTGCTGGG + Intergenic
1201225415 Y:11813824-11813846 GCTGCTACACAGATTTTTCTTGG + Intergenic
1201417699 Y:13763890-13763912 GCTGCTTCAAAGAGTTTTCTGGG + Intergenic
1201942572 Y:19475585-19475607 GGTGCTGCGAAGAGGGGTCTGGG + Intergenic