ID: 1179992634

View in Genome Browser
Species Human (GRCh38)
Location 21:44956530-44956552
Sequence CAGCATCTGAGTGGCTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 16, 3: 33, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992629_1179992634 8 Left 1179992629 21:44956499-44956521 CCGCTTCAGCTGGTGACCTGGGT 0: 1
1: 1
2: 4
3: 64
4: 371
Right 1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG 0: 1
1: 1
2: 16
3: 33
4: 185
1179992632_1179992634 -8 Left 1179992632 21:44956515-44956537 CCTGGGTGGTGTTGGCAGCATCT 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG 0: 1
1: 1
2: 16
3: 33
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992634 Original CRISPR CAGCATCTGAGTGGCTCTGT AGG Intronic
900010706 1:104518-104540 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
900026809 1:281082-281104 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
900035180 1:401873-401895 TAGCATCCGAGTTGCTCTGTTGG + Intergenic
900036606 1:414997-415019 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
900056800 1:637626-637648 TAGCATCCGAGTTGCTCTGTTGG + Intergenic
900058235 1:650745-650767 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
900545209 1:3224911-3224933 CAGCATCTCAGGGACTCTGGCGG + Intronic
901113660 1:6820614-6820636 CAGCTGCTGAGTGGCTCAGCTGG - Intronic
902441705 1:16434402-16434424 CAGCCTCTGAGTGGCTGGCTGGG + Intronic
903965839 1:27088891-27088913 CAGCATCTCAGCTTCTCTGTAGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907525360 1:55050759-55050781 CAGCCACTGAATTGCTCTGTAGG + Intronic
907703742 1:56815011-56815033 AAGCCTCTCAGTGGCTCTCTTGG + Intronic
908923721 1:69227268-69227290 CAGCATCTCAAGGGCTCTGTAGG - Intergenic
912759707 1:112356305-112356327 CCCCAACTGAGTGGCACTGTGGG - Intergenic
917199796 1:172502288-172502310 GAGCATATGAGTGGCTATGGTGG - Intergenic
920363417 1:205435196-205435218 CAGCACCTGGGTGGCTGTGTTGG - Intronic
922257712 1:223907429-223907451 TAGCATCCGAGTTGCCCTGTTGG + Intergenic
922259146 1:223920527-223920549 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
924338906 1:243010208-243010230 TAGCATCCGAGTTGCTCTGTTGG + Intergenic
924340337 1:243023275-243023297 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
924429738 1:243986733-243986755 CAGCAGCTGACTTGCCCTGTAGG - Intergenic
1066736163 10:38482337-38482359 TAGCATCTGAGTCGTTCTGTTGG + Intergenic
1067037613 10:42931769-42931791 CAGCATTTGAGTGCCTCCTTGGG - Intergenic
1067163673 10:43848044-43848066 CAGCTTCTGCATGGGTCTGTTGG - Intergenic
1069957475 10:72060887-72060909 CAGCATCTGTGAGCGTCTGTTGG - Exonic
1072042709 10:91624534-91624556 CAGTATCTGAATAGCACTGTAGG - Intergenic
1072258688 10:93646262-93646284 CAGAATCTCTGTGGGTCTGTAGG + Intronic
1072527946 10:96290579-96290601 CAGCTTCTGAGTGGCAGTGGGGG - Intergenic
1073422897 10:103438756-103438778 CAGCTTCTGAGGGGCTATGTAGG + Exonic
1075723904 10:124602099-124602121 CTGCATCTGGGTGTCTCTGGTGG - Intronic
1076209504 10:128629049-128629071 CAGCCACAAAGTGGCTCTGTGGG + Intergenic
1076696395 10:132249363-132249385 CAGCATCTGCATGGCTGTCTTGG - Intronic
1077196141 11:1281338-1281360 CGGCTTCTGAGTTGCTTTGTGGG + Intronic
1083723615 11:64617101-64617123 AAGCATGTGTGTGCCTCTGTTGG + Intronic
1083961616 11:66017771-66017793 CAGCAGCTGTCTGGCTCTGAGGG - Intronic
1084581290 11:70025009-70025031 GAGCATCTGAGGGTCTCAGTTGG + Intergenic
1085049018 11:73370371-73370393 CAGCAACTGACTGGCAGTGTGGG - Intergenic
1089159228 11:116424726-116424748 GACCACCTGAGTGGCTCTGTGGG - Intergenic
1089201642 11:116728085-116728107 CAGCATCTCAGTGACTGTGAGGG - Intergenic
1090466363 11:126937981-126938003 CAGCATCTCTGTGACTCTTTGGG - Intronic
1091008888 11:131980301-131980323 CAGCATCAATGGGGCTCTGTGGG - Intronic
1096561984 12:52442236-52442258 CAACTTCAGAGGGGCTCTGTGGG - Intergenic
1098189408 12:67932110-67932132 GCCCATCTGATTGGCTCTGTGGG + Intergenic
1098852072 12:75607791-75607813 CAGCAACTGATTGGCTATATAGG + Intergenic
1104815336 12:131642413-131642435 TTGCATCTGATTGGCTCTGATGG - Intergenic
1106006952 13:25779520-25779542 GGGCATCTGAATGGCTCAGTCGG + Intronic
1108572161 13:51762359-51762381 CAGCCTCTGAGTGGCTCTGTGGG - Exonic
1108989129 13:56632797-56632819 CAGCATGATACTGGCTCTGTGGG - Intergenic
1109226732 13:59705338-59705360 TAGAATCTGAGTGGCACCGTGGG - Intronic
1110397697 13:75050820-75050842 CTGCAGCTGGGTGGCTCTCTGGG - Intergenic
1113514577 13:110883616-110883638 CAGCAGGAGAGTGGTTCTGTTGG - Intronic
1117175459 14:53141628-53141650 CAGCTTCTGATTGCCTCTGTTGG - Intronic
1118740810 14:68738029-68738051 CGGCCTCTGAGTGGCTCAGTGGG - Intergenic
1119567404 14:75640549-75640571 CAGGATCTCCGTGGCTCTCTGGG - Intronic
1121960294 14:98253434-98253456 CAGCATGAGAGGGGCTCTGAAGG + Intergenic
1121992594 14:98574051-98574073 AGGCAGCTGAGTGGCTCTTTGGG - Intergenic
1122500242 14:102193216-102193238 CAGCTTCTGAGCGGCTCGGATGG - Intronic
1125747286 15:42005499-42005521 CAGCATTTGAGTGCCTGTGAGGG - Intronic
1126895791 15:53255935-53255957 CAGCTGCAGAGTGGCTCTGCTGG + Intergenic
1129296345 15:74602329-74602351 CTGCATCTGAGGGGCTCTTTGGG - Intronic
1129596458 15:76968045-76968067 CAGAATCCCAGTGGCTCTGTGGG - Intergenic
1129798693 15:78397256-78397278 CAGCGTCTGCGGGGCTCTGTTGG + Intergenic
1129993987 15:79989223-79989245 CAGCATCTGAGTGGCAGGGGTGG - Intergenic
1132780356 16:1621093-1621115 GAGCAGCTGTGTGGCTTTGTGGG + Intronic
1133124985 16:3640986-3641008 CCACATCCGAGTGGCCCTGTTGG - Intronic
1133395710 16:5445652-5445674 CATCATCTGAGTCACTCTGGTGG + Intergenic
1133988158 16:10684350-10684372 GAGCCTCTGTGTGTCTCTGTGGG + Intronic
1134470860 16:14524765-14524787 CAGGATCCGAGTGGCACTGATGG - Intronic
1135233064 16:20727766-20727788 AATCATCTGAGAGCCTCTGTGGG + Intronic
1136022628 16:27449695-27449717 CAGCATCTCCGGGGCTTTGTGGG + Exonic
1140045440 16:71437589-71437611 CAGCATCTGAGAGGCACTGGGGG + Intergenic
1140287436 16:73617843-73617865 TAGCATCTGGGTAGCTCTGAAGG - Intergenic
1141039050 16:80655815-80655837 CAGAGTCTGAGGGGCTCTGGAGG - Intronic
1141206860 16:81939421-81939443 CAGCATCTGAGTTGTTCATTGGG - Intronic
1141636043 16:85314410-85314432 CAGCATCTGTGTGGGGCTGTGGG + Intergenic
1142453640 16:90202398-90202420 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
1143409554 17:6700615-6700637 CAGCATCAGAGTGGTTCTGGAGG + Intronic
1144170286 17:12653395-12653417 CAGCATCTCAGGGGTTCTGATGG + Intergenic
1144764765 17:17726297-17726319 CTGCAGCTGAGTGGGTGTGTGGG - Intronic
1145910763 17:28540869-28540891 CAGCATATGAGTGGGAGTGTGGG - Intronic
1146683702 17:34826447-34826469 CAGCATTGGAGGAGCTCTGTCGG - Intergenic
1147188038 17:38723092-38723114 CAGGGTCTGAGTGGCTGTGCAGG + Intronic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1152320810 17:79608164-79608186 CTGCCTCTGAGTGGCTCAGCAGG - Intergenic
1152903344 17:82957532-82957554 CAGCATCTGTGTGCATCTGTGGG - Intronic
1153515330 18:5895911-5895933 CAGCATCCGAGGGGCGCTCTCGG + Exonic
1153654846 18:7273339-7273361 CAGCAGCTGAGCAGCTCTGCGGG - Intergenic
1155286394 18:24293422-24293444 CAGCAAATGGGAGGCTCTGTCGG - Intronic
1157671528 18:49533353-49533375 CAGCATCTGGGTCCCTGTGTCGG + Intergenic
1158010075 18:52718587-52718609 CTGCCTCCGTGTGGCTCTGTGGG + Intronic
1160062654 18:75547052-75547074 CATCATCTGTGTTTCTCTGTTGG - Intergenic
1161989905 19:7678743-7678765 TACCATCTGGGTTGCTCTGTGGG + Intronic
1162714487 19:12621555-12621577 CAGAATCTGAGTGCTTCTGATGG + Intronic
1162876014 19:13621614-13621636 CAGCATCTGAGAAGCCCTGGAGG - Intronic
1165937830 19:39399871-39399893 CACCCACTGAGTGCCTCTGTGGG - Exonic
1165952741 19:39483279-39483301 CAGCAGCTGGATGGCTTTGTGGG + Intronic
1166822942 19:45591746-45591768 CACCAACTGCCTGGCTCTGTGGG - Exonic
1166951591 19:46432052-46432074 CAGCACCGGAGCAGCTCTGTGGG + Intergenic
1167387488 19:49172297-49172319 CAGCATCTGCTTTCCTCTGTTGG + Intronic
928073589 2:28242202-28242224 CCGGATCTGTGTGGCACTGTTGG - Intronic
928700709 2:33895931-33895953 GAGCATTTGAGTGGCTCTAAAGG + Intergenic
929443913 2:41988210-41988232 CAGCATCTCAGTGCCTTTATGGG - Intergenic
932916469 2:75864689-75864711 CAGCCTGTGAGTTGCTGTGTGGG + Intergenic
935172316 2:100620106-100620128 GAGCACGTGGGTGGCTCTGTGGG - Intergenic
935336346 2:102020837-102020859 CAGGATCTCAGTGGCTCTCAAGG + Intronic
946360724 2:219218108-219218130 CAGCAGGTGAGGGACTCTGTGGG - Exonic
946857710 2:223969348-223969370 AAGCATCTCATTGGCACTGTAGG + Intergenic
948421583 2:237863658-237863680 CGGCTTCTGGGTGGCTTTGTTGG + Intronic
949085085 2:242147056-242147078 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
1168880753 20:1204328-1204350 CAGCAGCTGAGATGCTCTGCAGG + Intronic
1170030811 20:11942109-11942131 TAGCTTCTGAGTTGCTTTGTTGG + Intergenic
1170111548 20:12809009-12809031 CAGCATCTGAGTGCATCATTAGG + Intergenic
1172025627 20:31946365-31946387 CAGCCTGTGAGTGGCCCTGGAGG - Intronic
1173387810 20:42605024-42605046 AAGCATCTCAGAGTCTCTGTCGG + Intronic
1175478618 20:59295434-59295456 CAGCAGCAGAATGGCTATGTTGG - Intergenic
1175936294 20:62515637-62515659 CTGCATCTCAGAGGCTCTGAGGG + Intergenic
1176242352 20:64080960-64080982 CAGTATCTGGGTGCCCCTGTGGG + Intronic
1179377438 21:40863238-40863260 CAGTATCTTAGTGTCTCTTTTGG - Intergenic
1179658625 21:42860857-42860879 CTGCGTCTGAGTGGTTCTGTGGG - Intronic
1179992634 21:44956530-44956552 CAGCATCTGAGTGGCTCTGTAGG + Intronic
1181046654 22:20217813-20217835 CAGCATCTGAGGGGCCATGTGGG - Intergenic
1181067809 22:20314978-20315000 CAGATTCCGAGTGGCCCTGTTGG - Intronic
1181665577 22:24393861-24393883 CAGCAGATCAGTGGCTGTGTGGG - Intronic
1182307147 22:29378097-29378119 CAACATCTGAGGGACTCTGCAGG - Intronic
1182917367 22:34047380-34047402 CAGCATCTGAAAAGCCCTGTGGG - Intergenic
1182972340 22:34590137-34590159 GGACATCTGAGTGGGTCTGTGGG - Intergenic
1183896162 22:40970896-40970918 CAGTATCTGAGTGGTACTGTTGG + Intronic
1184365706 22:44049864-44049886 CAGCCTCTGTGTGGCTCTGGTGG + Intronic
1184455961 22:44609547-44609569 CAGCATCTTGGTAGCTCTGCAGG + Intergenic
953837831 3:46362488-46362510 CAGCACCTGAAAGGCTCTGCAGG + Intergenic
954313191 3:49786187-49786209 CAGCATCTGGGAGGCTCGGCGGG + Exonic
954918531 3:54169308-54169330 CATGAGCTGAGTGGGTCTGTGGG - Intronic
956750211 3:72339170-72339192 CTGAATCTGATTGGCTATGTGGG + Intergenic
959857235 3:111174023-111174045 TAGGATCTGGGTGGCTCTGTAGG + Intronic
960037582 3:113117340-113117362 CGGCATCTAAGTGCCTTTGTGGG + Intergenic
966412937 3:179661910-179661932 CAGCATCTGAGTGTCCTTCTGGG + Intronic
966576203 3:181505594-181505616 AAGCAGCTGAGTGGCTGTTTTGG + Intergenic
969325933 4:6443859-6443881 CTGCACCTGAGAGGCTGTGTGGG - Intronic
970088204 4:12371556-12371578 CAGCATCTGCTTGGCTTTGGGGG - Intergenic
970428995 4:15971535-15971557 CGGCCTCTAAGTGGCTCTCTGGG + Intronic
970909861 4:21262341-21262363 CAGCATCTGTGTCTCTTTGTTGG + Intronic
973248363 4:48035055-48035077 CAGAATTTGAGTGGTTCTTTAGG - Intronic
976584588 4:86780928-86780950 CAGCAGCTCAGTGGTTATGTGGG + Intronic
977895781 4:102363371-102363393 CAGCATTTGAGCGGACCTGTGGG + Intronic
978173680 4:105704675-105704697 TAGTGTATGAGTGGCTCTGTTGG - Intronic
978653694 4:111040696-111040718 CAGCATCTGAGTGCTTCTCATGG + Intergenic
979238215 4:118425030-118425052 TAGTATCCGAGTTGCTCTGTTGG - Intergenic
979262515 4:118665295-118665317 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
980159051 4:129137778-129137800 CAGAATCTCAGTGTCTCTTTTGG + Intergenic
984552291 4:181175028-181175050 AAGCATTTCAGTGGCTCTTTTGG - Intergenic
985435768 4:189928353-189928375 CAGCATCTGTGATGGTCTGTGGG - Intergenic
985481228 5:112092-112114 CAACAAGTGAGTGGCCCTGTCGG + Intergenic
986915437 5:12613708-12613730 CAGCAGCTGTGTTGCACTGTGGG + Intergenic
991233673 5:64367183-64367205 CACCACCAGACTGGCTCTGTAGG + Intronic
991937388 5:71815551-71815573 CAGGAGCAGAGTAGCTCTGTAGG + Intergenic
992645252 5:78805762-78805784 GAGCAGCCGGGTGGCTCTGTGGG + Intronic
993197031 5:84762595-84762617 CAGTCTCTGAGTGTCTCTATAGG + Intergenic
994691801 5:103028712-103028734 TAGCATCTATATGGCTCTGTAGG + Intronic
995072123 5:107935937-107935959 GAGAATCTGAGTGGGGCTGTAGG + Intronic
995501748 5:112814600-112814622 CAGCAGTTGAGTGGTTCTGAGGG - Intronic
996647076 5:125829117-125829139 CAGCCTCTGAGTGTCTCTTCTGG - Intergenic
997258354 5:132446202-132446224 TGGCATCTGAGTGGCTCCTTAGG + Intronic
998168041 5:139855716-139855738 GGGCATCTGCGTGGCTCTGCTGG - Exonic
1001087390 5:168710744-168710766 CAGCATCTGAGCCTCTTTGTGGG + Intronic
1002737215 5:181403865-181403887 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
1002738639 5:181416998-181417020 TAGCATCCGAGTTGCTCTGTTGG - Intergenic
1003283138 6:4711547-4711569 CAGCATCTGAATTGCCCTGAGGG - Intronic
1006240878 6:32677704-32677726 GAGAATCTGAGTGTCTCTATAGG + Intergenic
1007451786 6:41945608-41945630 CAGCATCTCAATGGGTCTGAAGG - Intronic
1007953285 6:45892439-45892461 CAGCATTTGACTGGCTTTTTGGG + Intergenic
1008617647 6:53241673-53241695 CAGCATCTGTCTTGCTCTCTTGG - Intergenic
1010505640 6:76655295-76655317 CAGCAAATGAGTGATTCTGTTGG + Intergenic
1011651745 6:89512587-89512609 CAGCATCTGTGTTTGTCTGTTGG + Intronic
1012545158 6:100411201-100411223 CGGCAGTTGAGTGGCTGTGTAGG - Intronic
1012625040 6:101394054-101394076 AAGCATGCAAGTGGCTCTGTTGG + Intergenic
1013611528 6:111800382-111800404 CAGCTTGTGGGAGGCTCTGTGGG + Intronic
1016171735 6:141026096-141026118 CAACTACTGACTGGCTCTGTGGG - Intergenic
1016404210 6:143713523-143713545 CAGCACCTAAGTGGCTTTCTGGG + Intronic
1017897402 6:158692591-158692613 CGGCATCAGATTGGCTGTGTGGG + Intronic
1018160569 6:161038142-161038164 CAGCATTTGAGTGACTCCATAGG + Intronic
1018430854 6:163721598-163721620 CAGCGTCTCTGTGCCTCTGTTGG - Intergenic
1018972995 6:168541479-168541501 CAGCATCAGAGTTGCTTTCTTGG + Intronic
1019242311 6:170679431-170679453 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
1019243743 6:170692550-170692572 TAGCATCCGAGTTGCTCTGTTGG - Intergenic
1020733530 7:11915433-11915455 CAGCATATGTCTAGCTCTGTGGG + Intergenic
1021916345 7:25436955-25436977 CATCATCTGAGCACCTCTGTGGG + Intergenic
1023418354 7:39951624-39951646 CAGGCTCTGAGAGGCCCTGTGGG - Exonic
1023655999 7:42421713-42421735 CAGCATCCCAGTGGCCATGTGGG + Intergenic
1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG + Intronic
1026807860 7:73438941-73438963 CCCCCTCTGAGTGGCTCTGTTGG + Intergenic
1029191818 7:98777404-98777426 CAGCAGTTGAGCGGCTCTGCTGG - Intergenic
1029402711 7:100355741-100355763 CAGCCTCTGGGTAGCTCTGGAGG - Intronic
1029405415 7:100371955-100371977 CAGCCTCTGGGTAGCTCTGGAGG - Intronic
1029484930 7:100834485-100834507 CAGCATCCAAGTGACTATGTGGG + Intronic
1030022648 7:105291134-105291156 CACCATCTGAGTGGTTTTGGTGG + Intronic
1033059264 7:138089835-138089857 CAGCACCTGAGAGGCAATGTGGG + Intronic
1033670618 7:143489157-143489179 CAGCATCTGAGGGACCCTGCTGG + Intergenic
1033805772 7:144953092-144953114 CTGCATCTCTGTGGCTTTGTAGG + Intergenic
1035318198 7:158010848-158010870 CAGCATCTGAGGTGCTCCATGGG - Intronic
1035504380 8:115610-115632 TAGCATCCGAGTTGCTCTGTTGG + Intergenic
1035505807 8:128719-128741 TAGCATCTGAGTCGCTCTGTTGG - Intergenic
1035617578 8:1013491-1013513 CAGCATCACAGGGTCTCTGTGGG + Intergenic
1035945063 8:3953731-3953753 GAGCAGCTCAGGGGCTCTGTGGG - Intronic
1036419521 8:8582947-8582969 CAGCCTCCGAGTGGCTATGTTGG - Intergenic
1036504996 8:9347225-9347247 CACGATCTCAGAGGCTCTGTGGG + Intergenic
1037434873 8:18851785-18851807 CAGAATCTGTGTAGCTCTTTGGG - Intronic
1037746305 8:21647689-21647711 CAGTGTCTGAGTGGGGCTGTGGG - Intergenic
1038102070 8:24388750-24388772 CAGCATCTAAGTGGATTTGTTGG - Intronic
1038737277 8:30182387-30182409 CCTCAGCTGTGTGGCTCTGTAGG + Intronic
1049504254 8:142986484-142986506 AAGCATCTTATTGGTTCTGTAGG + Intergenic
1049525866 8:143126704-143126726 TAGCACCTGAGTGGCCCCGTGGG - Intergenic
1049794415 8:144489976-144489998 CAGCATCTGCCTGGCTCCCTCGG + Intronic
1052974089 9:34399150-34399172 CAGCATGTGAGTGGATCCATGGG + Exonic
1056068165 9:82958420-82958442 CAGCATCTCAGGGACTCTGCAGG + Intergenic
1057224228 9:93279510-93279532 CTGCAGCTCATTGGCTCTGTCGG - Intronic
1057845106 9:98516889-98516911 CAGTGTCTGAATCGCTCTGTTGG - Intronic
1058272358 9:102988138-102988160 CAGTATATGAGTGTCTTTGTAGG - Intergenic
1059411509 9:114135209-114135231 CAGCGTCTGAGGGCCTCTGAGGG + Intergenic
1060967004 9:127717055-127717077 CAGCATGTGAATGGCTGTGTCGG - Intronic
1061113851 9:128595728-128595750 CAGCAGATGAGTGGCTGCGTGGG - Intronic
1203602502 Un_KI270748v1:28653-28675 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
1203603932 Un_KI270748v1:41773-41795 CAGCATCCGAGTTGCTCTGTTGG - Intergenic
1188654364 X:32672836-32672858 CCGTATCTCAGTGGCTCTTTTGG - Intronic
1189348807 X:40262136-40262158 CAGCAGCAGCCTGGCTCTGTGGG + Intergenic
1192268276 X:69555498-69555520 CAGCAACTGAGAGGCTGGGTGGG + Intergenic
1195034975 X:100964188-100964210 CAACATCTGTTTGGCTCTGGGGG - Intergenic
1197232797 X:124023862-124023884 CAGCATTTGACTGGGTATGTGGG + Intronic
1201359415 Y:13130232-13130254 AAGCATGTGTGTGGCTTTGTAGG - Intergenic
1201486622 Y:14501641-14501663 CAGCATCTGCTTGGCTTTTTAGG + Intergenic
1202182775 Y:22153665-22153687 GAGCCTCTGAGGGGCTCTGTGGG + Intergenic
1202208584 Y:22432736-22432758 GAGCCTCTGAGGGGCTCTGTGGG - Intergenic
1202384588 Y:24313758-24313780 TAGCATCTGAGTCGCTCTGTTGG + Intergenic
1202385992 Y:24326822-24326844 TAGCATCCGAGTTGCTCTGTTGG - Intergenic
1202484794 Y:25343306-25343328 TAGCATCCGAGTTGCTCTGTTGG + Intergenic
1202486196 Y:25356364-25356386 TAGCATCTGAGTCGCTCTGTTGG - Intergenic