ID: 1179992986

View in Genome Browser
Species Human (GRCh38)
Location 21:44958293-44958315
Sequence AGATGCTGGGCCTCAAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992986_1179992990 -8 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992986_1179993000 28 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179993000 21:44958344-44958366 TGGCATTTCTGCTGCACCCACGG 0: 1
1: 0
2: 1
3: 15
4: 175
1179992986_1179993001 29 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992986_1179992993 8 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992986 Original CRISPR AGATGCTGGGCCTCAAGCAA GGG (reversed) Intronic