ID: 1179992986 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:44958293-44958315 |
Sequence | AGATGCTGGGCCTCAAGCAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 165 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 14, 4: 149} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179992986_1179992990 | -8 | Left | 1179992986 | 21:44958293-44958315 | CCCTTGCTTGAGGCCCAGCATCT | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
Right | 1179992990 | 21:44958308-44958330 | CAGCATCTGCACTCCCAGCCCGG | 0: 1 1: 0 2: 6 3: 60 4: 448 |
||||
1179992986_1179993000 | 28 | Left | 1179992986 | 21:44958293-44958315 | CCCTTGCTTGAGGCCCAGCATCT | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
Right | 1179993000 | 21:44958344-44958366 | TGGCATTTCTGCTGCACCCACGG | 0: 1 1: 0 2: 1 3: 15 4: 175 |
||||
1179992986_1179993001 | 29 | Left | 1179992986 | 21:44958293-44958315 | CCCTTGCTTGAGGCCCAGCATCT | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
Right | 1179993001 | 21:44958345-44958367 | GGCATTTCTGCTGCACCCACGGG | 0: 1 1: 0 2: 1 3: 14 4: 168 |
||||
1179992986_1179992993 | 8 | Left | 1179992986 | 21:44958293-44958315 | CCCTTGCTTGAGGCCCAGCATCT | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
Right | 1179992993 | 21:44958324-44958346 | AGCCCGGCCCTCCTCCAAGCTGG | 0: 1 1: 0 2: 1 3: 20 4: 240 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179992986 | Original CRISPR | AGATGCTGGGCCTCAAGCAA GGG (reversed) | Intronic | ||