ID: 1179992987

View in Genome Browser
Species Human (GRCh38)
Location 21:44958294-44958316
Sequence CAGATGCTGGGCCTCAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992987_1179992993 7 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240
1179992987_1179993000 27 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179993000 21:44958344-44958366 TGGCATTTCTGCTGCACCCACGG 0: 1
1: 0
2: 1
3: 15
4: 175
1179992987_1179992990 -9 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992987_1179993001 28 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992987 Original CRISPR CAGATGCTGGGCCTCAAGCA AGG (reversed) Intronic