ID: 1179992989

View in Genome Browser
Species Human (GRCh38)
Location 21:44958307-44958329
Sequence CGGGCTGGGAGTGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992989_1179993000 14 Left 1179992989 21:44958307-44958329 CCAGCATCTGCACTCCCAGCCCG 0: 1
1: 0
2: 3
3: 27
4: 366
Right 1179993000 21:44958344-44958366 TGGCATTTCTGCTGCACCCACGG 0: 1
1: 0
2: 1
3: 15
4: 175
1179992989_1179993001 15 Left 1179992989 21:44958307-44958329 CCAGCATCTGCACTCCCAGCCCG 0: 1
1: 0
2: 3
3: 27
4: 366
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992989_1179992993 -6 Left 1179992989 21:44958307-44958329 CCAGCATCTGCACTCCCAGCCCG 0: 1
1: 0
2: 3
3: 27
4: 366
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992989 Original CRISPR CGGGCTGGGAGTGCAGATGC TGG (reversed) Intronic