ID: 1179992990

View in Genome Browser
Species Human (GRCh38)
Location 21:44958308-44958330
Sequence CAGCATCTGCACTCCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 448}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992981_1179992990 17 Left 1179992981 21:44958268-44958290 CCCAGGACAGTAGCAGCTCCCGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992986_1179992990 -8 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992987_1179992990 -9 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992985_1179992990 -2 Left 1179992985 21:44958287-44958309 CCGACACCCTTGCTTGAGGCCCA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992982_1179992990 16 Left 1179992982 21:44958269-44958291 CCAGGACAGTAGCAGCTCCCGAC 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448
1179992984_1179992990 -1 Left 1179992984 21:44958286-44958308 CCCGACACCCTTGCTTGAGGCCC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1179992990 21:44958308-44958330 CAGCATCTGCACTCCCAGCCCGG 0: 1
1: 0
2: 6
3: 60
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992990 Original CRISPR CAGCATCTGCACTCCCAGCC CGG Intronic