ID: 1179992991

View in Genome Browser
Species Human (GRCh38)
Location 21:44958321-44958343
Sequence GCTTGGAGGAGGGCCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 466}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992991_1179993000 0 Left 1179992991 21:44958321-44958343 CCCAGCCCGGCCCTCCTCCAAGC 0: 1
1: 0
2: 4
3: 45
4: 466
Right 1179993000 21:44958344-44958366 TGGCATTTCTGCTGCACCCACGG 0: 1
1: 0
2: 1
3: 15
4: 175
1179992991_1179993004 27 Left 1179992991 21:44958321-44958343 CCCAGCCCGGCCCTCCTCCAAGC 0: 1
1: 0
2: 4
3: 45
4: 466
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992991_1179993001 1 Left 1179992991 21:44958321-44958343 CCCAGCCCGGCCCTCCTCCAAGC 0: 1
1: 0
2: 4
3: 45
4: 466
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992991 Original CRISPR GCTTGGAGGAGGGCCGGGCT GGG (reversed) Intronic