ID: 1179992993

View in Genome Browser
Species Human (GRCh38)
Location 21:44958324-44958346
Sequence AGCCCGGCCCTCCTCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992989_1179992993 -6 Left 1179992989 21:44958307-44958329 CCAGCATCTGCACTCCCAGCCCG 0: 1
1: 0
2: 3
3: 27
4: 366
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240
1179992985_1179992993 14 Left 1179992985 21:44958287-44958309 CCGACACCCTTGCTTGAGGCCCA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240
1179992986_1179992993 8 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240
1179992987_1179992993 7 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240
1179992984_1179992993 15 Left 1179992984 21:44958286-44958308 CCCGACACCCTTGCTTGAGGCCC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240
1179992988_1179992993 -5 Left 1179992988 21:44958306-44958328 CCCAGCATCTGCACTCCCAGCCC 0: 1
1: 0
2: 4
3: 50
4: 487
Right 1179992993 21:44958324-44958346 AGCCCGGCCCTCCTCCAAGCTGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992993 Original CRISPR AGCCCGGCCCTCCTCCAAGC TGG Intronic