ID: 1179992996

View in Genome Browser
Species Human (GRCh38)
Location 21:44958331-44958353
Sequence AGAAATGCCAGCTTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 364}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992996_1179993001 -9 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992996_1179993000 -10 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993000 21:44958344-44958366 TGGCATTTCTGCTGCACCCACGG 0: 1
1: 0
2: 1
3: 15
4: 175
1179992996_1179993007 29 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179992996_1179993004 17 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992996 Original CRISPR AGAAATGCCAGCTTGGAGGA GGG (reversed) Intronic