ID: 1179992997

View in Genome Browser
Species Human (GRCh38)
Location 21:44958332-44958354
Sequence CAGAAATGCCAGCTTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992997_1179993004 16 Left 1179992997 21:44958332-44958354 CCTCCTCCAAGCTGGCATTTCTG 0: 1
1: 0
2: 1
3: 31
4: 320
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992997_1179993001 -10 Left 1179992997 21:44958332-44958354 CCTCCTCCAAGCTGGCATTTCTG 0: 1
1: 0
2: 1
3: 31
4: 320
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992997_1179993007 28 Left 1179992997 21:44958332-44958354 CCTCCTCCAAGCTGGCATTTCTG 0: 1
1: 0
2: 1
3: 31
4: 320
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992997 Original CRISPR CAGAAATGCCAGCTTGGAGG AGG (reversed) Intronic