ID: 1179992998 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:44958335-44958357 |
| Sequence | CAGCAGAAATGCCAGCTTGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 326 | |||
| Summary | {0: 1, 1: 0, 2: 5, 3: 42, 4: 278} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1179992998_1179993004 | 13 | Left | 1179992998 | 21:44958335-44958357 | CCTCCAAGCTGGCATTTCTGCTG | 0: 1 1: 0 2: 5 3: 42 4: 278 |
||
| Right | 1179993004 | 21:44958371-44958393 | CTCCTGTGCTTCCGCAGCACCGG | 0: 1 1: 0 2: 0 3: 22 4: 174 |
||||
| 1179992998_1179993007 | 25 | Left | 1179992998 | 21:44958335-44958357 | CCTCCAAGCTGGCATTTCTGCTG | 0: 1 1: 0 2: 5 3: 42 4: 278 |
||
| Right | 1179993007 | 21:44958383-44958405 | CGCAGCACCGGCGAGAGCTGTGG | 0: 1 1: 0 2: 0 3: 8 4: 90 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1179992998 | Original CRISPR | CAGCAGAAATGCCAGCTTGG AGG (reversed) | Intronic | ||