ID: 1179992999

View in Genome Browser
Species Human (GRCh38)
Location 21:44958338-44958360
Sequence GTGCAGCAGAAATGCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992999_1179993004 10 Left 1179992999 21:44958338-44958360 CCAAGCTGGCATTTCTGCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992999_1179993007 22 Left 1179992999 21:44958338-44958360 CCAAGCTGGCATTTCTGCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179992999_1179993009 30 Left 1179992999 21:44958338-44958360 CCAAGCTGGCATTTCTGCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1179993009 21:44958391-44958413 CGGCGAGAGCTGTGGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179992999 Original CRISPR GTGCAGCAGAAATGCCAGCT TGG (reversed) Intronic