ID: 1179993001

View in Genome Browser
Species Human (GRCh38)
Location 21:44958345-44958367
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992996_1179993001 -9 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992994_1179993001 -4 Left 1179992994 21:44958326-44958348 CCCGGCCCTCCTCCAAGCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 411
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992989_1179993001 15 Left 1179992989 21:44958307-44958329 CCAGCATCTGCACTCCCAGCCCG 0: 1
1: 0
2: 3
3: 27
4: 366
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992988_1179993001 16 Left 1179992988 21:44958306-44958328 CCCAGCATCTGCACTCCCAGCCC 0: 1
1: 0
2: 4
3: 50
4: 487
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992986_1179993001 29 Left 1179992986 21:44958293-44958315 CCCTTGCTTGAGGCCCAGCATCT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992997_1179993001 -10 Left 1179992997 21:44958332-44958354 CCTCCTCCAAGCTGGCATTTCTG 0: 1
1: 0
2: 1
3: 31
4: 320
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992995_1179993001 -5 Left 1179992995 21:44958327-44958349 CCGGCCCTCCTCCAAGCTGGCAT 0: 1
1: 1
2: 7
3: 25
4: 300
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992992_1179993001 0 Left 1179992992 21:44958322-44958344 CCAGCCCGGCCCTCCTCCAAGCT 0: 1
1: 0
2: 2
3: 51
4: 508
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992991_1179993001 1 Left 1179992991 21:44958321-44958343 CCCAGCCCGGCCCTCCTCCAAGC 0: 1
1: 0
2: 4
3: 45
4: 466
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168
1179992987_1179993001 28 Left 1179992987 21:44958294-44958316 CCTTGCTTGAGGCCCAGCATCTG 0: 1
1: 0
2: 2
3: 16
4: 242
Right 1179993001 21:44958345-44958367 GGCATTTCTGCTGCACCCACGGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type