ID: 1179993003

View in Genome Browser
Species Human (GRCh38)
Location 21:44958361-44958383
Sequence GGAAGCACAGGAGCGTCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179993003_1179993007 -1 Left 1179993003 21:44958361-44958383 CCACGGGACGCTCCTGTGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1179993007 21:44958383-44958405 CGCAGCACCGGCGAGAGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1179993003_1179993009 7 Left 1179993003 21:44958361-44958383 CCACGGGACGCTCCTGTGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1179993009 21:44958391-44958413 CGGCGAGAGCTGTGGTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 112
1179993003_1179993010 19 Left 1179993003 21:44958361-44958383 CCACGGGACGCTCCTGTGCTTCC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1179993010 21:44958403-44958425 TGGTGTGCTGGCCTTGTCGTAGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179993003 Original CRISPR GGAAGCACAGGAGCGTCCCG TGG (reversed) Intronic