ID: 1179993004

View in Genome Browser
Species Human (GRCh38)
Location 21:44958371-44958393
Sequence CTCCTGTGCTTCCGCAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 174}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179992998_1179993004 13 Left 1179992998 21:44958335-44958357 CCTCCAAGCTGGCATTTCTGCTG 0: 1
1: 0
2: 5
3: 42
4: 278
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992996_1179993004 17 Left 1179992996 21:44958331-44958353 CCCTCCTCCAAGCTGGCATTTCT 0: 1
1: 1
2: 1
3: 37
4: 364
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992994_1179993004 22 Left 1179992994 21:44958326-44958348 CCCGGCCCTCCTCCAAGCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 411
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992991_1179993004 27 Left 1179992991 21:44958321-44958343 CCCAGCCCGGCCCTCCTCCAAGC 0: 1
1: 0
2: 4
3: 45
4: 466
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992995_1179993004 21 Left 1179992995 21:44958327-44958349 CCGGCCCTCCTCCAAGCTGGCAT 0: 1
1: 1
2: 7
3: 25
4: 300
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992992_1179993004 26 Left 1179992992 21:44958322-44958344 CCAGCCCGGCCCTCCTCCAAGCT 0: 1
1: 0
2: 2
3: 51
4: 508
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992997_1179993004 16 Left 1179992997 21:44958332-44958354 CCTCCTCCAAGCTGGCATTTCTG 0: 1
1: 0
2: 1
3: 31
4: 320
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174
1179992999_1179993004 10 Left 1179992999 21:44958338-44958360 CCAAGCTGGCATTTCTGCTGCAC 0: 1
1: 0
2: 3
3: 26
4: 226
Right 1179993004 21:44958371-44958393 CTCCTGTGCTTCCGCAGCACCGG 0: 1
1: 0
2: 0
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179993004 Original CRISPR CTCCTGTGCTTCCGCAGCAC CGG Intronic